ࡱ>  nt7 { bjbjUU `7|7|l8ԫtP>T(|(M4OOOOOOO$Q  TOOgPOOc*H ׽y|OR44}P0P vTOTTo appear in Nucleic Acids Research Discovery of Novel Transcription Factor Binding Sites by Statistical Overrepresentation Saurabh Sinha and Martin Tompa Corresponding author: Martin Tompa Department of Computer Science and Engineering Box 352350 University of Washington Seattle, WA 98195-2350, U.S.A. 206-543-9263 fax: 206-543-8331 tompa@cs.washington.edu Understanding the complex and varied mechanisms that regulate gene expression is an important and challenging problem. A fundamental subproblem is to identify DNA binding sites for unknown regulatory factors, given a collection of genes believed to be coregulated. We discuss a computational method that identifies good candidates for such binding sites. Unlike local search techniques such as Expectation Maximization and Gibbs samplers that may not reach a global optimum, the method discussed enumerates all motifs in the search space, and is guaranteed to produce the motifs with greatest z-scores. We discuss the results of validation experiments in which this algorithm was used to identify candidate binding sites in several well studied regulons of Saccharomyces cerevisiae, where the most prominent transcription factor binding sites are largely known. We then discuss the results on gene families in the functional and mutant phenotype catalogues of S. cerevisiae, where the algorithm suggests many promising novel transcription factor binding sites. The program is available at http://bio.cs.washington.edu/software.html . Keywords: sequence analysis, motif, transcription factor binding site, regulatory element, z-score, regulon, MIPS catalogue. Introduction One of the major challenges facing biologists is to understand the varied and complex mechanisms governing the regulation of gene expression. This paper focuses on one important aspect of this challenge, the identification of binding sites in DNA for the factors involved in regulation. This is a necessary first step in determining which factors regulate the gene and how. The analysis of noncoding regions in eukaryotic genomes in order to identify regulatory elements is a difficult problem, and one that is not yet well solved. Some of the reasons for this difficulty are as follows: Binding sites of multiple interacting transcription factors often play a role in the regulation of a single gene. There can be great variability in the binding sites of a single factor, and the nature of the allowable variations is not well understood. The regulatory elements may be located quite far from the corresponding coding region, either upstream or downstream or in the introns. Any algorithm whose goal is to discover novel regulatory elements takes as input a set of regulatory regions of genes, many of which are suspected to contain a common regulatory element. There are many possible sources for such coregulated genes, including expression microarray experiments, gene knockout experiments, and functional classes from the literature. This paper focuses on the regulation of genes in the yeast Saccharomyces cerevisiae, since much is known both about its transcription factors and about the functions of its genes. A number of algorithms to discover general motifs have been proposed (1-9). Many of these algorithms are designed to find longer or more general motifs than are required for identifying transcription factor binding sites. The price paid for this generality is that many of the cited algorithms are not guaranteed to find globally optimal solutions, since they employ some form of local search, such as Gibbs sampling, expectation maximization, and greedy algorithms, that may terminate in a locally optimal solution. There have been some studies that have applied these local search techniques specifically to the problem of identifying transcription factor binding sites in S. cerevisiae, with some success (10-14). The number of well conserved bases in the collection of binding sites of a single S. cerevisiae transcription factor is typically six to ten (15-16). This number is small enough that, for this particular problem, one need not rely on such general local search heuristics. Instead, one can afford to use enumerative methods that guarantee global optimality. This is the approach taken by the current paper, whose method is most closely allied to those of van Helden et al. (17-19) and Tompa (20). There are also other studies using an enumerative approach to motif-finding (21-23). We review a motif model that is tailored to accurately represent transcription factor binding sites in S. cerevisiae. We then review an enumerative algorithm from Sinha and Tompa (24) called YMF (Yeast Motif Finder) which, given the regulatory regions of several related genes, is guaranteed to produce the motifs with greatest z-scores. The present paper focuses on the application of that method to classes of yeast genes. We first present the results of validation experiments in which YMF was used to identify candidate binding sites in several well studied regulons of S. cerevisiae, where the most prominent transcription factor binding sites are largely known. We then present results on gene families in the functional and mutant phenotype catalogues of S. cerevisiae taken from the MIPS database (25), where YMF suggests many novel transcription factor binding sites. Our goal was to discover motifs in the classes from these catalogues, since genes with common mutant phenotypes or common function may have the same regulatory mechanism, and hence may share informative binding sites. Hughes et al. (11) performed a similar analysis of the MIPS functional catalogue using AlignACE, a local search algorithm based on Gibbs sampling. There are a number of differences between their results and ours. Most important is that differences in the motif model and search method (local search heuristic vs. enumerative search) lead to different significant motifs. In a separate paper (Sinha and Tompa, in preparation) we compare the accuracy of YMF and other methods such as AlignACE on both simulated data and on yeast regulons. Those results suggest that YMF may provide more accurate prediction of regulatory elements. A second difference is that Hughes et al. (11) merge motifs found in different functional classes. As a result, the important connection between transcription factor binding site and gene function, necessary for understanding regulatory relationships, is not apparent from their tables whereas it is explicit in ours. Finally, Hughes et al. (11) report results only on the functional catalogue and not on the mutant phenotype catalogue. Materials and Methods Variability Among Binding Site Instances The first question that must be addressed is What constitutes a motif? for the application of transcription factor binding sites in S. cerevisiae. An inspection of transcription factor databases such as TRANSFAC (15, http://transfac.gbf-braunschweig.de/TRANSFAC/) and SCPD (16, http://cgsigma.cshl.org/jian/), and of the relevant literature (26-33), particularly Jones et al. (26), which is rich in examples, reveals that there is significant variation among the binding sites of any single transcription factor. Moreover, the nature of the variability itself varies from factor to factor, so that the correct motif model is far from clear. Certain trends that must be incorporated in the motif model do, however, emerge from this literature, particularly from SCPD (see the column labeled consensus in Table 1 for examples): 1. Many of the motifs such as the Gal4p binding site CGGNNNNNNNNNNNCCG have spacers varying in length from 1 to 11 bp. The spacers usually occur near the middle of the motif, often because the factors bind as dimers or tetramers. 2. The number of well conserved bases (not including spacers, of course) is usually in the range 6-10. This number is called the length of the motif. 3. When there is variation in a conserved motif position, it is often a transition (that is, the substitution of a purine for a purine, or a pyrimidine for a pyrimidine) rather than a transversion. This is because of the similarity in nucleotide size necessary to fit the transcription factor's fixed DNA-binding domain. Somewhat less often, the variation in a given position may be between a pair of complementary bases. Other positional variations are rarer. 4. Insertions and deletions among binding sites are uncommon, again because of the fixed structure of the factor's DNA-binding domain. Based on these observations, a motif for our application is a string of length 6-10 over the alphabet {A,C,G,T,R,Y,S,W }, with 0 or more consecutive N's inserted at the center, and a limited number of R (purine), Y (pyrimidine), S (strong), and W (weak) characters, also called degenerate symbols. We choose such a consensus model rather than (say) a weight matrix in order to be able to enumerate motifs. An examination of the 50 binding site consensi included in SCPD (16) revealed that the number of consensi that exactly fit this characterization is 34 (68%). About 10 more fit the characterization if very slight differences from the exact consensus are tolerated. Measure of Statistical Significance Given some set of (presumably coregulated) S. cerevisiae genes, the input to YMF is the corresponding set of promoter regions, each having length 800 bp and having its 32 end at the gene's translation start site. For each motif s, let Ns be the number of occurrences of s in the input sequences, allowing an arbitrary number of occurrences in both orientations per promoter region. A reasonable measure of s as a motif will reflect how unlikely it would be to have Ns occurrences, if the sequences were instead drawn at random according to the background distribution. We use as this measure the statistical significance of the z-score of Ns. First, to specify the background distribution, let X be a set of random DNA sequences of the same number and lengths as the input promoter sequences, but generated by a Markov chain of order m, whose transition probabilities are determined by the (m +1)-mer frequencies in the full complement of 6000+ promoter regions (each of length 800 bp) of S. cerevisiae. In our experiments, we chose m =3 in order for the background model to account for the TATA, AAAA, and TTTT sequences that are ubiquitous throughout the genome's promoter regions (17). Let the random variable Xs be the number of occurrences of the motif s in these random sequences X, and let E(Xs) and (Xs) be its mean and standard deviation, respectively. Then the z-score associated with s is zs = (Ns - E(Xs))/(Xs) . (1) The measure zs is the number of standard deviations by which the observed value Ns exceeds its expectation. See Leung et al. (34) for a detailed discussion of this statistic. The z-score zs obeys a normal distribution in the asymptotic limit as the total length of the input promoter regions increases (35). If the assumption of normality is inaccurate, it may not be as meaningful to compare the z-scores of different motifs. In view of this, YMF will be most accurate when the total length of the input promoter regions is large. The ultimate test of the method, however, is not whether the z-score passes normality tests, but whether YMF successfully predicts true transcription factor binding sites. Therefore, in order to demonstrate the robustness of the method, in the validation experiments on known regulons we report the results on regulons consisting of as few as 3 genes. Since YMF enumerates a large motif space, thereby sampling a large number of points from the distribution, it is expected that some motifs will have a high z-score by chance. To address this, we associate with z-score x a significance pmax(x), which measures the probability that the maximum z-score is at least x, if the input sequences were random. This maximum is taken over all motifs of the given length, number of spacers, and number of degenerate symbols. We precompute pmax for a variety of motif parameters and input sequence lengths, by simulation. Random sequences of the same length as the input promoter regions are generated according to the Markov model being used, and YMF is run on these random sequences. The maximum z-score reported is recorded. This experiment is repeated 100 times. The fraction of experiments that yielded maximum z-score at least x is used as an estimate of pmax(x). Algorithm Summary The algorithm used by YMF is summarized here. The inputs to the algorithm are as follows: 1. a set of promoter regions; 2. the number l of nonspacer characters in the motifs to be enumerated (called the motif length); 3. the maximum number w of spacers in the motifs; 4. the transition matrix for a 3rd order Markov chain modeling the background distribution of promoter regions. The parameters l and w, along with the implicitly assumed motif model, define a search space of all candidate motifs that will be evaluated. This space consists of all motifs that have l characters from {A,C,G,T,R,Y,S,W}, and between 0 and w spacers (N) in the middle. Typically, the maximum number of degenerate symbols (R, Y, S, or W) was restricted to 2 for computational efficiency, though YMF can be configured to handle different values of this parameter. YMF first makes a pass over the input sequences, tabulating the number Ns of occurrences of each motif s in either orientation, including overlapping occurrences. For each motif s for which Ns > 0, it then computes the mean and standard deviation of the motif count using a method described by Sinha and Tompa (24). Finally it uses Equation (1) to compute the z-score zs and pmax(zs), and outputs the motifs sorted by z-score. Because the number of motifs is exponential in l, we can afford this enumerative method only for modest values of l. In contrast, however, the running time is linear in the size of the input sequences, so that the method scales very well to larger gene families and longer promoter regions. The current implementation typically runs in a few seconds for motifs of length 6, on a Pentium processor with 256 MB memory. For length 9 motifs, it requires a few minutes. Both a web interface and the source code for YMF are freely available at http://bio.cs.washington.edu/software.html. Experimental Methods The maximum number w of spacers allowed in a motif was varied depending on the motif length parameter l. For l = 6, we used w = 11, which means that length 6 motifs were allowed to have between 0 and 11 spacers in the middle. This is in accord with observed motifs from SCPD. However, this introduces an inherent bias in the method toward finding motifs with spacers, since there are 11 times as many motifs with spacers as without. To include some runs without this bias, when YMF was run with l > 6, we used w = 0, i.e., no spacers allowed. There are three different types of postprocessing steps that were used to produce the most promising candidate binding sites to report. The first is a tool called FindExplanators (36). A set of promoter sequences having bindings sites for a few different transcription factors typically contains hundreds of statistically overrepresented motifs, most of them being minor variations of the true binding site motifs. YMF will report all these overrepresented motifs. For example, suppose a factor binds to tcacgct in a set of sequences, causing this motif to be overrepresented. Many of its variations, e.g. cacgctt or tcacgcw, are also likely to be overrepresented, simply because each has its number of occurrences artifically increased by the presence of tcacgct. FindExplanators is a tool that extracts the few significantly independent motifs from the vast number that are simply artifacts of these few. Since YMF evaluates a motif based on its total number of occurrences in a set of sequences, a motif may have a high z-score (low pmax) even if it occurs unusually often in only one of the promoters. Such motifs may not be interesting candidates for transcription factor binding sites. Multiple occurrences of a motif in a promoter suggest some significance, but a very large number of occurrences in the same promoter may suggest a repetitive element rather than a regulatory element. Thus motifs are post-processed so that those that have high z-scores due to a large number of occurrences in one or two promoters are not reported. For this purpose we developed a numerical measure that captures the notion of a motif being well distributed among the promoters. Given a set X of promoters and a motif s, we first count the occurrences of s in each promoter. Let X+ be the set of promoters that have at least one occurrence of s, and let D = {d1,d2,...,dp} (where p = |X+ |) be the distribution of occurrences of s in X+. Intuitively, a well distributed motif is one for which D has a low variance. However, the variance itself is not comparable for sample distributions obtained from different populations, so we normalize it by dividing by the expectation. Thus, our statistic is w = (i=1.. p (di ( ()2/(, where ( is the mean of the distribution D. We call this the w-score of motif s. Lower values of the w-score indicate better distributed motifs. Note that w is identical to the (2 statistic, and we use the (2 distribution with p-1 degrees of freedom to compute a significance threshold on the w-score. Notice that we compute w from X+ and not from X, since in general we may not find the binding site present in all the input promoter sequences. As another means of evaluating the motifs, we introduce a co-expression score, which measures the similarity of the expression profiles of the genes corresponding to X+. This score is computed from data in the database ExpressDB (37), which catalogues mRNA expression level information from several different studies under a common framework. The expression data is normalized across studies by converting them into estimated relative abundancies or ERAs. Such values are available for all yeast genes under 217 different conditions. For each pair of genes, we compute the correlation coefficient of their ERA values. Given the set X+, we compute the average pairwise correlation coefficient over all pairs of genes in X+. We then estimate a p-value of this average pairwise correlation coefficient, by choosing |X+ | random genes and computing the same score for these, and repeating several times. This p-value is called the co-expression score of X+ and a low value indicates that the genes in X+ have an unusually high pairwise correlation coefficient on average. Results and Discussion Validation on Known Regulons The SCPD database (16) has a collection of transcription factors and the genes regulated by each factor. Each such set of genes comprises a regulon. For each gene in a regulon, the database lists the experimentally determined binding sites of the transcription factor, and in many cases the consensus sequence of the binding sites in the regulon is also given. It is not always clear from the binding sites alone what their consensus should be, because there is often more than one way to align them, and to choose a consensus with degenerate symbols. Hence, we rely on the consensus listed at SCPD. YMF was run on each regulon in SCPD that has at least three genes and has a catalogued consensus sequence for its binding sites. There are 23 such regulons. The success of YMF was assessed by comparing the top motifs reported with the known consensus for the regulon. The program was run three times on each regulon, to find motifs of length 6, 7, and 8, respectively. For length 6 motifs, a maximum of 11 spacers in the middle was allowed. For lengths 7 and 8, the motif model did not include spacers. (See Materials and Methods for details.) In all runs, a maximum of 2 degenerate symbols (R, Y, S, or W) was allowed in the candidate motifs. The results are summarized in Table 1. Each row corresponds to a regulon. For each of the three runs of YMF on that regulon, the motif with greatest z-score is presented, along with its total count in the input promoter regions, its z-score z, and pmax(z). Lower pmax values are indicative of higher statistical significance. (See Materials and Methods.) Reported motifs that can be superimposed with the known consensus for the regulon without conflicting characters at any position, and that have at least four positions (possibly degenerate symbols) identical to the consensus, are considered matches and are typeset in bold letters. For 15 of the 23 regulons, the top motif reported (for one or more value of the motif length parameter) was a match. For 14 of the 15 regulons, there was a match with pmax less than 0.1, the exception being MATa2. In another regulon, MCM1, the top ranking motifs (for length 6) were variants of the poly-A element (any motif that can be instantiated to a string of all As, e.g., AAAAWAAA), and the first non-poly-A motif, at rank 11 with pmax 0.01, was CCSNNNNAGG, similar to the known consensus CCNNNWWRGG. For the regulon RAP1, the top motif reported (for length 7) is GCAYGTG, which matches part of the Inositol/Choline Response Element (ICRE) with consensus SCAYRTGAARW. (We discuss this motif and its connection to the RAP1 regulon shortly.) The first motif reported by YMF (for the same length parameter) that is not a variant of GCAYGTG, is RCACCCA, at rank 11, with pmax 0.02. Note that this closely matches the known consensus RMACCCA for the RAP1 regulon. For the regulon HSE,HSTF, the consensus catalogued at SCPD is GAANNTCC. However, an alignment of the known binding sites of this transcription factor, as reported in the same database, reveals a consensus pattern of TCTAGAA. This closely matches the top motif TCYAGAA reported by YMF for significant length 7. Thus, counting MCM1, RAP1, and HSE,HSTF also as successes, we are left with only five regulons (GCR1, ROX1, SFF, TBP, and UASPHR) on which YMF failed to report any match to the known binding site consensus. Note that the 23 regulons represent the typical input for a motif-finder they are of varying sizes (3 to 38 genes) and have a variety of known binding sites (length 5 to 10, with few to many spacers or degenerate symbols). The results thus demonstrate the applicability of the method on a variety of data sets. In most cases, a match was found in the top three motifs for multiple values of l, indicating that the performance is not crucially dependent on prior knowledge of the motif length. In some cases, YMF found a match even though the known consensus of the binding site does not conform to the motif model YMF uses. For instance, the regulon SCB has the sequence CNCGAAA as its binding site consensus, with an N that is not in the middle. Nevertheless, a very similar motif CACGAAA was reported. Similarly, for HAP1 (consensus CGGNNNTANCGG), the motif SGGNNNNNNSGG was discovered. The regulon ABF1 is an example of a case where multiple occurrences of the binding site are found in the same promoter region. Of the 19 genes in this regulon, 8 have two or more occurrences of the motif TCRNNNNNNACG in their promoter region. There are a total of 36 occurrences of the motif, giving it a very high z-score of 10.07. If each of the 19 genes had only one occurrence of the motif, for a total of 19 occurrences, the z-score would have been about 4.03, which is rather low, meaning that the motif would not have been reported as significant. As noted above, a pmax value of 0.1 or less served as a good indicator of a significant motif, in the sense that most of the matches occurred with pmax less than 0.1. We therefore examined all motifs (from Table 1) that are reported to have a pmax value less than this threshold, to see if there are interesting signals in the regulon that are different from the known binding sites, and also to have an idea of the false positive rate. Table 2 summarizes our observations. It includes each motif from Table 1 that has a pmax value less than 0.1, is not a poly-A, poly-T or TATA motif, and is not a match. There are 13 such motifs. Three of them (CGCWCGG, CGCACGGA in the GAL4 regulon, and ARCCGCCG in the MIG1 regulon) occur overlapping with known Gal4 binding sites in the respective promoters. The motif CGGNNNNNNNNNNNCCG in the MIG1 regulon is identical to the Gal4 binding site consensus, and this family contains the genes Gal3, Gal10, Gal1, and Gal4, which are known to contain this binding site. The motif GCAYGTG in the RAP1 regulon matches a prefix of the ICRE consensus SCAYRTGAARW (38-39). Among the genes of this regulon are Fas1, known to contain the ICRE motif (40), and Opi3 and Itr1, both known to have the similar motif CATGTGAA, which is shared by promoters of phospholipid synthetic enzymes such as these two (25). Thus, for five of the motifs in Table 2, there is strong evidence that they correspond to known binding sites of other transcription factors, leaving eight motifs about which we do not have any clear evidence. Even if we regard all these eight motifs as spurious, the resulting false positive rate would be small, considering that a total of 39 motifs in Table 1 meet the criteria of having pmax less than 0.1 and not being a poly-A, poly-T or TATA motif. Some occur at approximately conserved position relative to the translation start site, strengthening the possibility that they might be targets of other transcription factors. Results on MIPS Catalogues The MIPS database at the Munich Information Center for Protein Sequences (25) catalogues yeast genes classified according to different criteria. One such catalogue is based on gene function, while another classifies genes based on phenotypes with which mutant versions of the genes have been implicated. These catalogues will be referred to as the functional and the phenotype catalogue, respectively. Each catalogue has a hierarchical organization, the different levels of the hierarchy corresponding to different degrees of specificity of the classification criterion. Our goal was to discover motifs in the classes from these catalogues, since many genes with common mutant phenotypes or common function may have the same regulatory mechanism, and hence may share binding sites. We extracted from each catalogue the classes that were at or near the bottom of the hierarchy and had 5 or more genes. YMF was run on the 800 bp long promoter regions of genes in each class, with the same set of parameter values as in the experiments on SCPD regulons. In some cases, a class of genes contains one or more pairs of divergent genes, whose promoter regions overlap. For such pairs, the single promoter region between the two genes replaced two separate promoters. The top 1000 motifs from each of the three runs of YMF were input to the program FindExplanators (see Materials and Methods), which reported the three best independent motifs in its input list of 1000 motifs. For classes with over 100 genes, only the single best motif of the 1000 was reported, for computational efficiency. For each motif obtained from the previous step, the w-score (see Materials and Methods) was computed to measure how well distributed the motif is, and motifs with poor w-scores (at 95% level of significance) were rejected. All motifs with pmax greater than 0.1, as well as those that are poly-A, poly-T, or TATA repeats were rejected. Matches of each of the remaining motifs to binding sites of known transcription factors in yeast (as catalogued in the database TRANSFAC) are reported. Also, for each remaining motif, the co-expression score was computed (see Materials and Methods) for the set of genes in the class that contain the motif in their promoters. Functional Catalogue There were 204 classes extracted from the functional catalogue, and the motif-finding steps reported a total of 930 motifs. Tables 3a and 3b present a selection of the results. This selection was done by manual inspection of the 930 reported motifs, using the following more stringent criteria. Motifs with pmax greater than 0.05 were eliminated. If a single functional class had motifs of different lengths that were variants of each other, only that with the least pmax value was retained. Motifs that had more than two matches to known binding sites of the same transcription factor are presented in Table 3a, while the others are in Table 3b, and are good candidates as novel transcription factor binding sites. Most of the motifs in Table 3a match the known binding site consensus of some transcription factor, in which case the name of the factor is reported along with the consensus. Some of the motifs in this table do not match a known consensus, but do match two or more binding sites of a single transcription factor. For such motifs, we report the name of the factor, along with the number of matching binding sites. In either case, it would be interesting to pursue, for each of the motifs in the table, whether the transcription factor whose binding sites it matches has some regulatory role for the genes in that functional class. For instance, the motif CACGTGSG, which matches the Pho4 consensus, is found to be significant in the functional class phosphate metabolism (Table 3a), and it may be verified from the literature that the Pho4 transcription factor indeed regulates many of the genes in this class that have the motif in their promoters. Many other similar connections can be found in the comments column of Table 3a. We will now discuss some of the most interesting observations from Table 3b, showing that some of these motifs are excellent candidates as novel transcription factor binding sites. The 7-mer CGATGAG is highly overrepresented in the promoters of the functional class rRNA transcription. This motif was also discovered by Hughes et al. (11), who recognized it as the PAC box (41), an element for which neither function nor binding factor has been identified. It occurs a total of 50 times in 45 of the 109 promoters in the class, with a z-score 17.00 and pmax less than 0.01. It is a very well distributed motif, its 50 occurrences being spread over 45 promoters. Moreover, these 45 promoters belong to genes that are highly co-expressed. Their co-expression score is 0.04, which means that the average pairwise correlation coefficient of their expression data has a p-value of 0.04. Another property that makes this motif a very compelling candidate for a binding site is its extremely high conservation in position in the promoter sequences. Fig. 1 illustrates this point. It shows a plot of the occurrences of the motif in the 45 promoters, the 32 end being on the right. We also plotted this motif in promoter regions of orthologs of the 45 yeast genes in other yeast species (Fig. 2). The orthologous genes considered here belong to other yeast strains, and the orthology information was obtained from Paul Cliften (personal communication). We see that the motif occurs frequently and is conserved in position in these orthologous promoters also, even though the orthologous genes were identified based on their protein sequences. Moreover, a very similar motif GATGAGS is found to be significant in the related functional class tRNA transcription. This motif occurs 45 times in 34 promoters of the class, with a z-score of 9.11 (pmax less than 0.01). Another motif worth special mention is the 8-mer CGGAGWWA, which occurs in the functional class C-compound and carbohydrate transporters that has 46 genes. It occurs a total of 28 times in 16 different promoters of this class, whose corresponding genes have a co-expression score of 0.05. This motif is significantly well conserved in its location (Fig. 3), though not as strongly as the previous motif. Included in the 16 promoters of the class that contain the motif are 9 of the glucose transporting HXT genes (Hxt2, Hxt3, Hxt5, Hxt8, Hxt11, Hxt13, Hxt15, Hxt16, and Hxt17). The regulation of these genes has been the subject of detailed biological studies. One study by Theodoris and Bisson (42) shows that DNA sequence dependent suppressing elements (DDSEs) located in the promoters of HXT genes affect glucose sensing, and the authors further hypothesize that the DDSE region contains binding sites for the Rgt1p transcriptional repressor/activator. Rgt1p is believed to bind to promoters of Hxt2, Hxt3, and Hxt4. However, the Rgt1p binding site they propose for the HXT genes is TTTCACGGAAAATTATATTTTG, which does not match our motif CGGAGWWA. A review by Ozcan and Johnston (43) describes another mechanism that represses transcription of some HXT genes in high glucose conditions through Mig1, which is a transcription factor (repressor) known to bind to the promoter of Hxt2 and Hxt4 genes. Again, we verified that the known binding sites of Mig1 (consensus CCCCRNNWWWWW) do not match the motif CGGAGWWA. Only limited information is available on the expression of Hxt5 and Hxt8 to Hxt17. In fact, it is not even certain if these are involved in glucose transport - they could act as transporters for other sugars. Hxt11 is bound by the transcription factor PDR3, though the PDRE (the binding site for PDR3, with consensus TCCGYGGA) does not match our motif CGGAGWWA. The promoter of Hxt13 was obtained in a screen for targets of the transcription factor Hap2, whose binding sites are quite different from CGGAGWWA. Gal2, a galactose permease that is more than 60% similar to the HXT proteins, is also one of the 16 genes whose promoters contain the motif under investigation. However, it is well established that Gal2 is regulated by the Gal4p transcription factor, which binds to the element CGGNNNNNNNNNNNCCG. In summary, while much is known about the transcriptional regulation of the glucose transporting genes, none of the known mechanisms seems to explain the presence of such a strong shared motif, which is therefore worth investigating further. The motif AAWTTTTY occurs 170 times in 52 of the 64 promoters of the class translation, with a z-score of 9.95 (pmax less than 0.01). These 52 genes are highly co-expressed, as indicated by a co-expression score of 0.01. Another compelling feature of the motif is its high conservation in location in the promoters, as revealed by Fig. 4. The class amino acid transport has a significant motif GCCGTRCS, which occurs 13 times in 9 promoters of the class, with a very high z-score of 17.70 (pmax less than 0.01). Among the 9 promoters that have this motif are TAT1, DIP5, GAP1, and GNP1. SPS-initiated signals are known to modulate the expression of these four genes (44), and it would be interesting to find out if the discovered motif is related to this known regulation. Phenotype Catalogue The phenotype catalogue from MIPS yielded 138 classes. All motifs reported by the motif-finding steps described above were examined. There were a total of 530 such motifs. Tables 4a and 4b present a selection from these motifs. Once again, we find among these motifs both known binding sites (Table 4a) and novel motifs (Table 4b) that may be good candidates for experimental verification. The motifs in Table 4a match the binding sites of the transcription factors Reb1, Mcb, repressor of Car1, Cbf1, Rap1, Mata1, and Pho4. It would be interesting to find out if these transcription factors are known to regulate some of the genes in the respective phenotype classes. We now discuss some of the most interesting motifs reported in Table 4b. The motif GTYGCCG occurs a total of 9 times (z-score 8.30, pmax 0.01) in 7 of the 14 promoters of the class sensitivity to immunosuppressants. The 7 promoters belong to highly co-expressed genes, as indicated by the low co-expression score of 0.015. The motif does not match any known transcription factor binding site. The motif CTSCCCSG, found in the class mating efficiency, deserves special mention. It occurs 8 times in 7 different promoters of the class, with a z-score of 9.56 (pmax 0.01). An interesting feature of this motif is that its instances occur, with up to one mismatch, overlapping Gal4p binding sites in five of the six genes regulated by this transcription factor. Though it does not match the Gal4p consensus CGGNNNNNNNNNNNCCG, this coincidence seems worth investigating. Another interesting motif is CCGCACRC, found in four of the 21 promoters of the class killer toxin resistance. It occurs a total of 5 times in these promoters, with a z-score of 10.30 (pmax 0.04). The occurrences of the motif are conserved in position in the four promoters, as Fig. 5 reveals. Moreover, the four corresponding genes are highly co-expressed, having a co-expression score of 0.025. Unclassified Proteins The MIPS database also has a table of 230 ORFs with strong sequence similarity to known proteins. YMF was run on sets of genes that have similarity to the same protein or family of proteins, and in some cases significant motifs were reported. For instance, there are seven ORFs with a strong similarity to members of the SRP1/TIP1 family. YMF reported two strong motifs AGGCAY (pmax less than 0.01) and TCGTWYA (pmax less than 0.01) in this set. Both these motifs were found to be significant when YMF was run on the 8 members of the SRP1/TIP1 family, thereby furthering evidence for a relation between the 7 unclassified ORFs and the SRP1/TIP1 family. Further Research In Tables 3a and 4a, it would be interesting to pursue connections (if not already described in these tables) between the known transcription factor listed in the last column and the gene family in which it was found, to determine whether the transcription factor plays a role in the regulation of genes in this family. Even more interesting would be to pursue the novel motifs listed in Tables 2, 3b, and 4b to see whether they lead to transcription factors of heretofore unknown function. Finally, the motif model described in Materials and Methods was developed from a study of S. cerevisiae transcription factor binding sites. It would be very interesting to understand whether this model is also suitable for the discovery of transcription factor binding sites in other organisms and, if not, how it should be modified. It is relatively easy to extend our algorithm to handle motif models where a motif corresponds to a fixed set of strings over the alphabet {A,C,G,T,N}. The mismatch model, where the motif is a string over this alphabet, and its occurrences may have some fixed number of mismatches from the consensus, belongs to this category of models. Acknowledgments We thank Linda Breeden and Chris Roberts for sharing their insights on transcription factor binding sites, Mathieu Blanchette and Rimli Sengupta for numerous thorough and helpful discussions, and Jacques van Helden for helpful comments. This material is based upon work supported in part by the National Science Foundation and DARPA under grant DBI-9601046, in part by the National Science Foundation under grant DBI-9974498, and in part by a Microsoft Fellowship. References Bailey, T. L. and Elkan, C. (1995) Unsupervised learning of multiple motifs in biopolymers using expectation maximization. Machine Learning, 21, 51-80. Fraenkel, Y. M., Mandel, Y., Friedberg, D. and Margalit, H. (1995) Identification of common motifs in unaligned DNA sequences: application to Escherichia coli Lrp regulon. Computer Applications in the Biosciences, 11, 379-387. Galas, D. J., Eggert, M. and Waterman, M. S. (1985) Rigorous pattern-recognition methods for DNA sequences: Analysis of promoter sequences from Escherichia coli. J. of Mol. Biol., 186, 117-128. Hertz, G. Z. and Stormo, G. D. (1999) Identifying DNA and protein patterns with statistically significant alignments of multiple sequences. Bioinform., 15, 563-577. Lawrence, C. E., Altschul, S. F., Boguski, M. S., Liu, J. S., Neuwald, A. F. and Wootton, J. C. (1993) Detecting subtle sequence signals: a Gibbs sampling strategy for multiple alignment. Science, 262, 208-214. Lawrence, C. E. and Reilly, A. A. (1990) An expectation maximization (EM) algorithm for the identification and characterization of common sites in unaligned biopolymer sequences. Proteins: Structure, Function, and Genetics, 7, 41-51. Rigoutsos, I. and Floratos, A. (1998) Motif discovery without alignment or enumeration. In RECOMB98: Proceedings of the Second Annual International Conference on Computational Molecular Biology, pp. 221-227. Rocke, E. and Tompa, M. (1998) An algorithm for finding novel gapped motifs in DNA sequences. In RECOMB98: Proceedings of the Second Annual International Conference on Computational Molecular Biology, pp. 228-233. Staden, R. 1989. Methods for discovering novel motifs in nucleic acid sequences. Computer Applications in the Biosciences, 5, 293-298. Chu, S., DeRisi, J., Eisen, M., Mulholland, J., Botstein, D., Brown, P. O. and Herskowitz, I. (1998) The transcriptional program of sporulation in budding yeast. Science, 282, 699-705. Hughes, J. D., Estep, P. W., Tavazoie, S. and Church, G. M. (2000) Computational identification of cis-regulatory elements associated with groups of functionally related genes in Saccharomyces cerevisiae. J. Mol. Biol., 296, 1205-1214. Roth, F. P., Hughes, J. D., Estep, P. W. and Church, G. M. (1998) Finding DNA regulatory motifs within unaligned noncoding sequences clustered by whole-genome mRNA quantitation. Nature Biotech., 16, 939-945. Spellman, P. T., Sherlock, G., Zhang, M. Q., Iyer, V. R., Anders, K., Eisen, M. B., Brown, P. O., Botstein, D. and Futcher, B. (1998) Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol. Biol. of the Cell, 9, 3273-3297. Tavazoie, S., Hughes, J. D., Campbell, M. J., Cho, R. J. and Church, G. M. (1999) Systematic determination of genetic network architecture. Nature Genetics, 22, 281-285. Wingender, E., Dietze, P., Karas, H. and Knppel, R. (1996) TRANSFAC: a database on transcription factors and their DNA binding sites. Nucleic Acids Res., 24, 238-241. Zhu, J. and Zhang, M. Q. (1999) SCPD: a promoter database of the yeast Saccharomyces cerevisiae. Bioinform., 15, 563-577. van Helden, J., Andr, B. and Collado-Vides, J. (1998) Extracting regulatory sites from the upstream region of yeast genes by computational analysis of oligonucleotide frequencies. J. Mol. Biol,. 281, 827-842. van Helden, J., Olmo, M. and Prez-Ortin, J. (2000) Statistical analysis of yeast genomic downstream sequences reveals putative polyadenylation signals. Nucleic Acids Res., 28, 1000-1010. van Helden, J., Rios, A. and Collado-Vides, J. (2000) Discovering regulatory elements in non-coding sequences by analysis of spaced dyads. Nucleic Acids Res., 28, 1808-1818. Tompa, M. (1999) An exact method for finding short motifs in sequences, with application to the ribosome binding site problem. In Proceedings of the Seventh International Conference on Intelligent Systems for Molecular Biology, AAAI Press, pp. 262-271. Brzma, A., Jonassen, I., Vilo, J. and Ukkonen, E. (1998) Predicting gene regulatory elements in silico on a genomic scale. Genome Res., 15, 1202-1215. Sagot, M. (1998) Spelling Approximate Repeated or Common Motifs Using a Suffix Tree. In Latin '98: Theoretical Informatics, Springer-Verlag Lecture Notes in Computer Science 1380, 111-127. Pavesi, G., Mauri, G. and Pesole, G. (2001) An algorithm for finding signals of unknown length in DNA sequences. Bioinform., 17, S207-S214. Sinha, S. and Tompa, M. (2000) A statistical method for finding transcription factor binding sites. In Proceedings of the Eighth International Conference on Intelligent Systems for Molecular Biology, AAAI Press, pp. 344-354. Mewes, H.W., Albermann, K., Heumann, K., Liebl, S. and Pfeiffer, F. (1997) MIPS: A database for protein sequences, homology data and yeast genome information. Nucleic Acids Res., 25, 28-30. Jones, E. W., Pringle, J. R. and Broach, J. R., eds. (1992) The Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression. Cold Spring Harbor Press, Cold Spring Harbor, NY. Blaiseau, P.-L., Isnard, A.-D., Surdin-Kerjan, Y. and Thomas, D. (1997) Met31p and Met32p, two related zinc finger proteins, are involved in transcriptional regulation of yeast sulfur amino acid metabolism. Mol. and Cell. Biol., 17, 3640-3648. Mai, B. and Breeden, L. (1997) Xbp1, a stress-induced transcriptional repressor of the Saccharomyces cerevisiae Swi4/Mbp1 family. Mol. and Cell. Biol., 17, 6491-6501. McInerny, C. J., Partridge, J. F., Mikesell, G. E., Creemer, D. P. and Breeden, L. L. (1997) A novel Mcm1-dependent element in the SWI4, CLN3, CDC6, and CDC47 promoters activates M/G1-specific transcription. Genes & Development, 11, 1277-1288. Nurrish, S. J. and Treisman, R. (1995) DNA binding specificity determinants in MADS-box transcription factors. Mol. and Cell. Biol., 15, 4076-4085. Oshima, Y., Nobuo, O. and Harashima, S. (1996) Regulation of phosphatase synthesis in Saccharomyces cerevisiae - a review. Gene, 179, 171-177. Roulet, E., Bucher, P., Schneider, R., Wingender, E., Dusserre, Y., Werner, T. and Mermod, N. (2000) Experimental analysis and computer prediction of CTF/NFI transcription factor DNA binding sites. J. Mol. Biol., 297, 833-848. Wemmie, J. A., Szczypka, M. S., Thiele, D. J. and Moye-Rowley, W. S. (1994) Cadmium tolerance mediated by the yeast AP-1 protein requires the presence of an ATP-binding cassette transporter-encoding gene, YCS1. J. Biol. Chem., 269, 32592-32597. Leung, M.-Y., Marsh, G. M. and Speed, T. P. (1996) Over- and underrepresentation of short DNA words in herpesvirus genomes. J. Comput. Biol., 3, 345-360. Nicodme, P., Salvy, B. and Flajolet, P. (1999) Motif statistics. In 7th Annual Symposium on Algorithms ESA99. Springer-Verlag Lecture Notes in Computer Science, pp. 194-211. Blanchette, M. and Sinha, S. (2001) Separating real motifs from their artifacts. Bioinform., 17, S30-S38. Aach, J., Rindone, W. and Church, G.M. (2000) Systematic management and analysis of yeast gene expression data. Genome Res,. 10, 431-445. Bachhawat, N., Ouyang, Q. and Henry, S. A. (1995) Functional characterization of an inositol-sensitive upstream activation sequence in yeast. A cis-regulatory element responsible for inositol-choline mediated regulation of phospholipid biosynthesis. J. Biol. Chem., 270, 25097-95. Schller, H.-J., Richter, K., Hoffman, B., Ebbert, R. and Schweizer, E. (1995) DNA binding site of the yeast heteromeric Ino2p/Ino4p basic helix-loop-helix transcription factor; structural requirements as defined by saturation mutagenesis. FEBS Letters., 370, 149-152. Wagner, C., Blank, M., Strohmann, B. and Schller, H.-J. (1999) Overproduction of the Opi1 repressor inhibits transcriptional activation of structural genes required for phospholipid biosynthesis in the yeast Saccharomyces cerevisiae. Yeast., 15, 843-854. Dequard-Chablat, M., Riva, M., Carles, C. and Sentenac, A. (1991) RPC19, the gene for a subunit common to yeast RNA polymerases A (I) and C (III). J. Biol. Chem., 266, 15300-15307. Theodoris, G. and Bisson, L.F. (2001) DDSE: downstream targets of the SNF3 signal transduction pathway. FEBS Microbiology Letters, 197, 73-77. Ozcan, S. and Johnston, M. (1999) Function and regulation of yeast hexose transporters. Microbiol. Mol. Biol. Rev., 63, 554-569. Forsberg, H., Gilstring, C.F., Zargari, A., Martinez, P. and Ljungdahl, P.O. (2001) The role of the yeast plasma membrane SPS nutrient sensor in the metabolic response to extracellular amino acids. Mol. Microbiology, 42, 215- 28. Lowndes, N.F., Johnson, A.L., Breeden, L. and Johnston, L.H. (1992) SWI6 protein is required for transcription of the periodically expressed DNA synthesis genes in budding yeast. Nature, 357, 505-508. Kean, L.S., Grant, A.M., Angeletti, C., Mahe, Y., Kuchler, K., Fuller, R.S. and Nichols, J.W. (1997) Plasma membrane translocation of fluorescent-labeled phosphatidylethanolamine is controlled by transcription regulators, PDR1 and PDR3. J. Cell Biol., 138, 255-70. Cheng, C., Kacherovsky, N., Dombek, K. M., Camier, S., Thukral, S. K., Rhim, E. and Young, E. T. (1994) Identification of potential target genes for Adr1p through characterization of essential nucleotides in UAS1. Mol. Cell. Biol., 14, 3842-3852. NAMESIZECONSENSUSl = 6Nszpmaxl = 7Nszpmaxl = 8NszpmaxABF119TCRN[6]ACGTCAN[6]ACG2910.560.00TTTYYTT1807.960.01AGSCYCGC719.930.11CAR112AGCCGCCR*TTTNNNTTY1469.090.00TTTTYTT1128.860.01AGCCGCCG414.180.00CPF13TCACGTGCACGWG96.940.40YCACGWG89.660.10CACGTGGC319.490.00CSRE4YCGGAYRRAWGGCGGN[6]GGA912.430.00CTCCGGG310.220.04CGGGCCCG214.790.08GAL46CGGN[11]CCGCGGN[11]CCG2832.720.00CGCWCGG613.110.00CGCACGGA317.140.00GCN38TGANTNTGACTC4412.540.00RTGASTC4713.760.00TGASTCAY3115.870.00GCR16CWTCCTTTN[4]TYY1118.530.04SCAYGTG108.550.11CGGGATTC313.920.08HAP15CGGNNNTANCGGSGGN[6]SGG89.010.05TGSCCCC58.500.13GGGGSCAW511.180.61HSE6GAANNTCCAACNNNCRG146.270.52TCYAGAA126.980.65ACTCCGTG29.360.93MATa27CRTGTWWWWATGN[10]CAY256.780.21CATGTWW177.310.41YCACGAAA79.760.81MCB6WCGCGWACGCGT1611.980.00RACGCGT1213.970.00SCGACGCG420.220.00MCM123CCNNNWWRGGARAN[4]AAR31710.660.00TRTRTAT819.010.00ATAYAYAT5813.090.00MIG19CCCCRNNWWWWWCGGN[11]CCG1614.950.00CCCCRGR98.560.03ARCCGCCG513.200.05PDR37TCCGYGGACCGNGGA2828.390.00CCGYGGA2838.560.00TCCGYGGA2455.170.00PHO45CACGTKSCACGT1812.120.00CACGTGS1014.420.00CACGTGGG316.750.00RAP116RMACCCACSCNNNCRC309.300.00GCAYGTG1310.370.00CCCGWYGC711.370.06REB114YYACCCGRAAN[5]AAR2199.860.00TTACCCG1214.100.00ATTACCCG817.940.00ROX13YYNATTGTTYAAANNAAA5911.710.00AAARRAA7111.810.04CCGACGTC215.990.09SCB3CNCGAAACACGAA109.440.01CACGAAA1015.920.00YCACGAAA920.050.00SFF3GTMAACAAATTN[9]TTW286.370.74GATCTAT47.180.86ACACTCCG213.250.28STE124ATGAAATRCN[7]GGW176.560.44ATGAAAC99.440.07ACAARGCC511.930.48TBP17TATAWAWAAANNNAAA1277.920.00TTTTYTT1307.740.02AAARAAAA8910.460.14UASPHR17CTTCCTTAYNTAY1077.460.01CRRCAAC268.150.02CARCARCA2513.490.01 Table 1. Performance of YMF on regulons in SCPD with known binding sites. NAME: name of the transcription factor; SIZE: number of genes in the regulon; CONSENSUS: the known consensus of the binding site, according to SCPD. The remaining columns tabulate the results of YMF for the three runs (l = 6, 7, 8 respectively) on that regulon. Each column lists the most significant motif found, its total count Ns, its z-score z, and pmax(z). Boldface indicates a match to the known consensus. * The consensus for CAR1 listed at SCPD is AGCCGCSA, but an alignment of the 12 listed sites suggests the consensus AGCCGCCR. NAMEMOTIFNszpmaxCOMMENTSCSRECTCCGGG310.220.04Occurs in 2 of 4 genes; roughly conserved in position.CGGGCCCG214.790.08Occurs in only one gene.GAL4CGCWCGG613.110.00All occurrences overlap Gal4 binding sites (in Gal1, Gal2, Gal7 and Gal10).CGCACGGA317.140.00All occurrences overlap Gal4 binding sites (in Gal1, Gal2 and Gal7).GCR1CGGGATTC313.920.08Occurs in 3 of 6 genes; roughly conserved in position.MIG1CGGN[11]CCG1614.950.00Is identical to the GAL4 motif.ARCCGCCG513.200.05Occurs overlapping with known Gal4 binding sites in Gal3, Gal10, and Gal1. The other two occurrences are in Fbp and Fps1.RAP1CSCNNNCRC309.300.00Occurs in 13 of 16 genes; roughly conserved in position.GCAYGTG1310.370.00Is similar to the ICRE motif (39).CCCGWYGC711.370.06Occurs in 3 of 16 genes; well conserved position.ROX1CCGACGTC215.990.09Occurs only in Rox1 gene.UASPHRCRRCAAC268.150.02Occurs in 7 of 17 genes; roughly conserved in position.CARCARCA2513.490.01Occurs in 3 of 17 genes; not conserved in position. Table 2. Motifs in SCPD regulons that are different from the known principal binding sites. The table lists the motif sequence, its total count Ns, its z-score z, and pmax(z). NAMEMOTIFNszpmaxCOMMENTSRegulation of amino acid metabolismYCACGTGC1114.780.00CBF1 (TCACGTG) has role in amino acid metabolism (MIPS)Nitrogen and sulfur metabolismTCACGTG187.940.00CBF1 (TCACGTG) has role in nitrogen and sulfur metabolism (MIPS)Tricarboxylic-acid pathwayTCACGTG118.450.00CBF1 (TCACGTG) Other transcription activitiesTCACGTG167.650.00CBF1 (TCACGTG)Mitochondrial transportTCACGTG197.410.00CBF1 (TCACGTG)Anion transporters (Cl, PO4 etc.)CACGTG206.890.00PHO4 (CACGTK) has role in phosphate metabolism (MIPS)Phosphate metabolismCACGTGSG1219.090.00PHO4 (CACGTK) has role in phosphate metabolism (MIPS)Homeostasis of phosphateCACGTGSG517.530.00PHO4 (CACGTK) has role in phosphate metabolism (MIPS) DNA synthesis and replicationACGCGW12416.040.00MCBF (WCGCGW) is involved in DNA synthesis (45)DNA repairACGCGWW497.770.00MCBF (WCGCGW) binds to MCB in DNA replication genes (TRANSFAC)Deoxyribonucleotide metabolismACGCGY2711.850.00MCBF (WCGCGW) is involved in DNA synthesis (45)Cellular importYCCCCAC277.690.00MIG1 (CCCCRNNWWWWW) is known to regulate some of the HXT genes in this class. (43)C-compound, carbohydrate transportCYCCRC7710.430.00MIG1 (CCCCRNNWWWWW) has role in C-compound metabolism (MIPS)C-compound, carbohydrate transportersCCCCRC409.390.00MIG1 (CCCCRNNWWWWW) has role in C-compound metabolism (MIPS)MeiosisTAGCCGCC2323.540.00Repressor of CAR1 (AGCCGCCR) has role in meiosis (MIPS)Amino acid transportersGCCGCCGA512.810.00Repressor of CAR1 (AGCCGCCR) has role in amino acid metabolism (MIPS)Homeostasis of metal ionsGSACCC467.600.00Rap1 (RMACCCA) Cation transportersGSACCC426.710.00Rap1 (RMACCCA)Regulation of amino acid metabolismRTGN[5]GTR938.910.00Matches 9 RAP1 binding sitesRibosome biogenesisAYCCRTAC10428.870.00Matches 4 RAP1 binding sites. Rap1 controls transcription of most ribosome protein genes (MIPS)Assembly of protein complexesTTANCCG527.210.00REB1 (YYACCCG)Cytoplasmic and nuclear degradationTTACCCG2810.930.00REB1 (YYACCCG)Vesicular transport (Golgi network)TACCCGG229.200.00REB1 (YYACCCG)Cellular communication mechanismTTACCCG178.620.00REB1 (YYACCCG)Cell growth / morphogenesisTYACCCG307.860.00REB1 (YYACCCG)Intracellular transport vesiclesTACCCGG118.650.00REB1 (YYACCCG)Vacuole or lysosomeTTACCCG157.510.00REB1 (YYACCCG)CytoskeletonTTACCCG269.450.00REB1 (YYACCCG)General transcription activitiesTTACCCG198.950.00REB1 (YYACCCG)Purine ribonucleotide metabolismTGACTC316.900.00GCN4 (TGANTN) regulates general control in response to purine starvation (MIPS)Amino acid transportersTSASTC546.400.03GCN4 (TGANTN) is a transcriptional activator of amino acid biosynthetic genes (MIPS)Drug transportersCSGN[9]CGS409.240.00Matches 4 GAL4 binding sitesCell wallTCCGAA337.510.00Matches 5 GAL4 binding sitesDirectional cell growth (morphogenesis)CRYN[6]CGA446.060.05Matches 5 TAF binding sitesIntracellular transport vesiclesCGTN[7]GAY406.250.00Matches 11 BAF1 binding sites. Baf1 is a multifunctional protein involved in transcriptional regulation of various genes (MIPS)Extracellular / secretion proteinsCCTAATT127.320.05Matches 3 MCM1 binding sites. Three (Mfalpha 1 and 2, HSP150) of the five genes that have this motif are known to be regulated by MCM1 (SCPD). Nitrogen and sulfur utilizationGATAAG529.580.00GATA box (GATAAG). The four GATA-binding factors (Gtz3, Dal80, Gln3, Gat1) regulate the expression of nitrogen catabolic genes (MIPS)Nitrogen and sulfur metabolismAAGATAAG2310.760.00GATA box (GATAAG). The four GATA-binding factors (Gtz3, Dal80, Gln3, Gat1) regulate the expression of nitrogen catabolic genes (MIPS)Other cation transportersAGAYAAG327.660.00GATA box (GATAAG)Lipid and fatty-acid transportTCCGCGGR1218.190.00PDR1/PDR3 (TCCGYGGA) Homeostasis of metal ionsTCCGYGGA139.180.02PDR1/PDR3 (TCCGYGGA) are implicated in transcription of two of the four genes in this class that have the motif (46)Transport mechanismCCGYGGA248.480.00PDR1/PDR3 (TCCGYGGA) are implicated in transcription of five of the nine genes in this class that have the motif (46)C-compound and carbohydrate transportersTCCGYGS268.390.00PDR3 (TCCGYGGA) binds Hxt11Cation transportersYGSACCC329.160.00AFT1 (TRCACCC) is involved in homeostasis of iron (MIPS)Metabolism of energy reserves (glycogen, trehalose)CCCCTGA1310.200.00STRE (CCCCT) is a Stress Response Regulatory Element. Three (TPS1, GSY1, PGM2) of the 11 genes in this class that have this motif are induced by stress.Proteolytic degradationGGTGGCAA3817.710.00RPN4 (GGTGGCAAA)PeroxisomeTYGGRGT307.360.00ADR1 (TYGGRG) regulates peroxisomal genes (MIPS, 47) Table 3a. Significant motifs in classes from the MIPS functional catalogue. The last column is the name of the known transcription factor binding site whose consensus sequence is similar to the found motif. The consensus sequence was obtained from SCPD (16) for all except the following: the consensus for MET was obtained from van Helden et al. (17), and the consensus for RPN4 from Hughes et al. (11). NAMESIZEMOTIFNszpmaxamino acid transport23GCCGTRCS1317.700.00 GYCGCCGA713.470.00 GAWAGCG199.080.00 amino acid degradation (catabolism)35CGGN[10]YCG298.940.00GACTSCGS1414.990.00regulation of nitrogen and sulphur utilization29CGGN[10]SGS276.630.01 purine ribonucleotide metabolism45GGCTAGGA710.690.01 deoxyribonucleotide metabolism11CGCN[8]GYG178.870.00 polynucleotide degradation27CTYATCGC910.230.02 nucleotide transport14CGCGSGC1013.110.00 phosphate transport10CGGN[4]GSS199.220.00 regulation of lipid, fatty-acid and isoprenoid metabolism20CGSN[6]CCS236.830.00 biosynthesis of vitamins, cofactors, and prosthetic groups63CTGN[5]GAC336.660.00 glycolysis and gluconeogenesis35TASGTAW468.520.00 CTCWSCCC1411.590.01 CGTSSGG168.310.00 tricarboxylic-acid pathway citrate cycle, Krebs cycle, TCA cycle25CGGCGCCG817.920.00GCWN[5]RGC546.920.00glyoxylate cycle6CCGN[5]SSG1811.660.00 other energy generation activities16CGCACCGC413.470.00 DNA restriction or modification32CACN[11]WCC387.330.00 rRNA transcription109CGATGAG5017.000.00 tRNA transcription83GATGAGS459.110.00 translation64AAWTTTTY1709.950.00 cytoplasmic and nuclear degradation99TTGCCAC5113.080.00 mitochondrial transport80SGCCSGG237.590.00 G-protein mediated signal transduction12CCCN[7]CGS138.520.00 homeostasis of anions13TCGN[7]SCR287.620.01 perception of nutrients and nutritional adaptation25CCSN[4]CCS308.250.00 cell death10GSCN[4]CCS198.050.01 nucleus31ATCACST217.050.01 GCGGATCC511.490.00 cell wall38AGATCTCG1115.370.00 GGYCCST197.300.00 centrosome31TTWSGCG276.860.03 chromosome44ACTCGCCG510.420.03 regulator of G-protein signalling13CTACTCG67.980.04 target of regulation13CTACTCG67.980.04 cation transporters62CGCN[6]CGS317.400.00 ion transporters79CGSSCGC278.200.00 C-compound and carbohydrate transporters46CGGAGWWA2814.170.00 amino acid transporters25GATAGCGA610.290.02 allantoin and allantoate transporters9CGCNCGC910.130.00 drug transporters35CGACAGG108.370.00 CGGCGCTA611.620.01 Table 3b. Significant novel motifs in classes from the MIPS functional catalogue. NAMEMOTIFNszpmaxCOMMENTSG1 arrestATTACCC137.330.02REB1 (YYACCCG)Mating efficiencyTTACCCG128.810.00REB1 (YYACCCG)Bud localizationTTACCCG128.150.00REB1 (YYACCCG)Osmotic sensitivityTTACCCG137.790.00REB1 (YYACCCG)Cytoskeleton mutantsTTACCCG279.530.00REB1 (YYACCCG)Secretory mutantsTTACCCG2010.210.00REB1 (YYACCCG)Carbohydrate and lipid biosynthesis defectsCGCGWCG117.190.00MCBF (WCGCGW)DNA repair mutantsACGCGW8310.980.00MCBF (WCGCGW) is involved in DNA synthesis (45)DNA replication mutantsACGCGW409.130.00MCBF (WCGCGW) binds to MCB in DNA replication genes (TRANSFAC)Respiratory deficiencyGSCGCCGA1811.460.00Repressor of CAR1 (AGCCGCCR)Vanadate resistanceGYCGSCG79.530.04Repressor of CAR1 (AGCCGCCR)Recombination mutantsTAGCCGCC811.020.00Repressor of CAR1 (AGCCGCCR)Divalent cations and heavy metalsGYSGCCG276.510.05Repressor of CAR1 (AGCCGCCR)Methionine auxotrophyTCACGTGC517.730.00CBF1 (TCACGTG) null mutant is methionine auxotroph (MIPS)Elongated cell & bud morphologiesTCCGTAC96.690.05Matches 3 RAP1 binding sitesElongated cell & bud morphologiesCAANNNCAR736.010.04Matches 3 Mata-1 binding sites Divalent cations and heavy metalsCACGTGS278.000.00PHO4 (CACGTK) Table 4a. Significant motifs in classes from the MIPS phenotype catalogue. The last column is the name of the known transcription factor binding site whose consensus sequence is similar to the found motif. The consensus sequence was obtained from SCPD (16) . NAMESIZEMOTIFNszpmaxRapamycin7CCTGCTTC614.680.04 Sensitivity to immunosuppressants14GTYGCCG98.300.01 G2/M arrest38ACCCGCCC510.680.02 Mating efficiency31CCGN[4]GGS206.950.00 CGTCGGTA510.040.00 CTSCCCSG89.560.01 Methionine auxotrophy9CCGN[8]CCG89.950.00 GGSCGGG69.950.00 CCTN[4]CYC209.550.00 ACGGGCGC314.240.02 Galactose fermentation14GGGGCCCS513.990.00 CCGN[6]CGG107.340.02 Other carbon utilization defects27CCGTAGAC613.960.00 CCRNNNCGS336.440.02 Nitrogen utilization8GGCNNGCC128.830.02 TGCGGCG59.470.01 Other auxotrophies20GTGACYC129.230.00 Bud localization35GTCGGGTA510.160.02 TAYGTRT457.900.00 ACSCGA296.490.01 Elongated cell and bud morphologies32RGGN[7]GGW536.800.00 TCCGTAC96.690.05 Papulacandin B sensitivity22GCTGCTGY1211.100.00 Killer toxin resistance21CCGCACRC510.300.04 Killer toxin29CSGN[5]CGC176.690.01 GCGN[9]ASR466.590.01 Zymolyase sensitivity31CCGN[5]SGY316.230.02 Hygromycin B sensitivity26GRAGATG267.070.04 Spindle mutants26TTTGYTT507.240.02 Benomyl sensitivity30GTRN[11]TGW866.430.01 Other tubulin cytoskeleton mutants15CGGNNSCG147.040.03 CCCGCGAG312.290.03 CGGGTCYG412.030.03 Secretory mutants61CGAN[9]CGA307.360.00 Mitochondrial mutants37CGGN[5]CSG237.150.00 CCCGGRC97.190.00 WAASCTG427.110.00 pH-sensitivity9GCGGCSGC820.960.00 CCYN[8]GGC147.750.03 Vacuolar mutants65GRRTTTG606.860.03 Starvation sensitivity26ACAN[9]ATA476.250.04 Other oxidizing agents15ARGN[6]AGG368.640.00 Oxidizing agents32ACCNNACY356.300.01 Divalent cations and heavy metals resistance13GGCN[7]GSC208.550.00 Divalent cations and heavy metals sensitivity69GCSGCCGY148.780.05 ACWNNNACA1288.230.00 Carbohydrate and lipid biosynthesis defects47CGYN[9]CGY588.050.00 Other DNA repair mutants32TATGTAY297.270.00 Silencing mutants26CTGGGGTC49.980.03 CCGGTAGA611.530.00 Recombination mutants55ARGNNAAG1286.930.00 CRGTCGG126.990.02 DNA replication mutants30CGTGCGCC410.740.00 Staurosporine sensitivity7CGGN[7]ACC88.400.03 Caffeine sensitivity34CARN[10]AGC516.480.01  Table 4b. Significant novel motifs in classes from the MIPS phenotype catalogue.  EMBED Word.Picture.8  Figure 1. Occurrences of motif CGATGAG in 45 promoters of the MIPS functional class rRNA transcription. Each horizontal line represents a promoter, the right end being at the translation start site. Vertical bars represent motif occurrences.  EMBED Word.Picture.8  Figure 2. Occurrences of motif CGATGAG in orthologous promoters of genes in the MIPS functional class  rRNA transcription . The orthology information was obtained from Paul Cliften (Personal Communication). The sequences are plotted with their 32 ends on the left, contrary to the convention followed in other similar plots in this paper.  Figure 3. Occurrences of motif CGGAGWWA in 16 promoters of the MIPS functional class C-compound and carbohydrate transporters.  Figure 4. Occurrences of motif AAWTTTTY in 52 promoters of the MIPS functional class translation.  Figure 5. Occurrences of motif CCGCACRC in 4 promoters of the MIPS phenotype class killer toxin resistance. PAGE 3 PAGE 36  #%~Rjf~2 ? = ? b o  kltz H&Sc!!"#%%&&:&;&F&G&V&W&f&g&&ֿֿֿֿֿֿֿCJCJ^J5CJOJQJ6CJCJ CJOJQJ5CJH*OJQJ5CJOJQJ6CJOJQJCJOJQJ]K$%}~3@Rjk a b o p 6  & F%ddddd^ z 6 IJkl;<  IJ !!z"#$p%q%*(ddd & F%d&&,(t(((P)p)B*D*P*R*T***++,,,,,,,,,,----.*.J.K........//,/-/H/I/U/V/0000000000000000000011,1.10111122<2@2B2H2I26CJCJ6CJ H*OJQJ5CJ CJOJQJ6CJOJQJT*(,(t(v(01;2<255888899!999*:+:==x?y? d7$8$H$d d7$8$H$$da$ddI2J2333355555555555555!6(6)6,6>6?666677[8]8l8m888888888890919{999999::<:@:A::::;;;&;';m;n;p;q;s;t;y;z;@<A<B<`<a<<<< CJOJQJCJH* CJOJQJ5CJCJPJ6CJH*PJ 6CJPJ6CJCJ 6CJ H*P<<<b=d=j=k=l=m=q=r=u=v=w=x=y=====>>????@@@@m@n@t@u@@@AABB!D(DDDDDE$EE*F,F7F8F;F*OJQJPJ 6H*PJ6PJOJQJ65CJ 6CJH*CJ6CJT[[[\Z\b\\\ ]'][_\___````5a*OJQJ6PJ6CJPJOJQJ 6H*PJRkkketztHwP{S]g{%ÛěTUefdddddrretztuuuNvOvRv||||j}k}|}}}}}~~+,<=@Έֈ!:B8@XigoώЎӎ9:KLOfg{ls 6OJQJOJQJOJQJCJPJCJOJPJQJ 6H*PJ OJPJQJ6H*OJPJQJ6OJPJQJ OJPJQJCJCJPJ6CJH*PJD;<LMPAR)*;<?%šŚÛ TUe9DϢѢӢk{cruxŽźź6CJOJQJ5CJOJQJ\6CJOJQJ] CJOJQJCJ6CJOJQJ CJOJQJ5CJ 6H*PJ6PJCJ 6OJQJOJQJOJQJ6H*OJPJQJ6OJPJQJ;f89Dܢݢ)*ҩөªê & F&dddܦަߦD ©ĩǩ8;ubzL[]_\tvHTUVW\fðưȰXβ HL 5CJ\h CJ]h 6CJhCJh6CJOJQJ5CJOJQJ\6CJOJQJ] CJOJQJNjkef$%հְԱձ02WX˵ & F&d7$8$H$]d & F&dd d & F&dL˴Դ״ٴP˵̵k|Ƕ./1Ը׸ٸʹ̹ιK^acǺߺǻӻֻٻżȼ˼Wfij} $%!.16CJH*OJQJ]CJH*OJQJ6CJOJQJCJh6hh5CJOJQJ\6CJOJQJ] CJOJQJL˵̵IJ>?۹ܹpqڼۼuv()$d & F&dd$%@AOPST #$  J^ `Jd7$8$H$]^ & F&d7$8$H$]d & F&d<d`<14A2>ADP|}#<>CFHw͉CJOJPJQJ OJPJQJ5PJCJPJ >*CJPJ5CJOJQJ\6CJOJQJ] CJOJQJ6CJOJQJ]6CJOJQJCJOJQJh 5CJ\h 6CJ]hCJh CJOJQJ5CJOJQJ\6 !$&+,14?JMSXd $$Ifa$$IfFf $$Ifa$>]> !"$'*+?I=FOVBCQX .4B 6CJPJH*PJ 5CJPJCJPJCJOJPJQJ6CJOJQJ6CJH*OJPJQJ]6CJOJPJQJ]LX`dinwy\4Ff $$Ifa$Ff $$Ifa$$If #().0=HJPU]_e`Ffh $$Ifa$ $$Ifa$$Ifejsu{dDFf $$Ifa$Ff4 $$Ifa$$If%*+028CGLQY\afoqH $$Ifa$Ff $$Ifa$$Ifqw|}XDFfd $$Ifa$Ff$If $$Ifa$ #$*,6BEJOWZ_dmotyX $$Ifa$Ff0 $$Ifa$$Ifyz~<hFf $$Ifa$ $$Ifa$$IfFf "#(*7CFLQY[`enpv{|dPFf`$ $$Ifa$Ff!$If $$Ifa$ @Ff,' $$Ifa$$If $$Ifa$  %(0:=BGORX]fhnsty|PXFf, $$Ifa$Ff) $$Ifa$$If X $$Ifa$Ff/$If $$Ifa$ $&.58=BJMSXacinosu~<HFf(5 $$Ifa$ $$Ifa$Ff\2$IfBIY`06VaRSTZ\bcijmnop$)457:=>GHb1I!9 !D\ 6CJPJCJOJPJQJ6H*OJPJQJ]6OJPJQJ] OJPJQJH* 6H*PJ6PJ6H*6PJ5PJCJOJPJQJCJPJ 5CJPJB HTFf: $$Ifa$Ff7 $$Ifa$$If",05:BFKPY\bghoryPFf= $$Ifa$ $$Ifa$$If%&().479>G $$Ifa$>]>FfX@ $$Ifa$$IfGHMUW]?H9900 $$Ifa$$If$$IfTs^ֈn 5 "2064+4 sa]b:$$IfTs4ֈn 5 "`2064+4 sa$If1$$IfTs4ֈn 5 " 2064+4 sa$If $$Ifa$1 $$Ifa$$If123<>D@t::11 $$Ifa$$If$$IfTs4ֈn 5 "`2064+4 saDI:L$$IfTs4ֈn 5 " 2064+4 sa$If2$$IfTsֈn 5 "2064+4 sa$If $$Ifa$! $$Ifa$$If!"#,.4@H::11 $$Ifa$$If$$IfTs4ֈn 5 "`2064+4 sa49:X$$IfTs4ֈn 5 " 2064+4 sa$If 1$$IfTs4ֈn 5 "`2064+4 sa$If $$Ifa$ !D $$Ifa$$IfDEFOQW@(::11 $$Ifa$$If$$IfTs4ֈn 5 " 2064+4 saW\:$$IfTs4ֈn 5 " 2064+4 sa$If2T$$IfTsֈn 5 "2064+4 sa$If $$Ifa$ $$Ifa$$If2fgp $%&*-.78\sy!"=RX_bcڼ򡚐{{{ CJPJ^JPJ6H*OJPJQJ]6OJPJQJ] OJPJQJ >*CJPJCJOJPJQJ6CJH*OJPJQJ6CJOJPJQJ66CJH*OJQJ6CJOJQJ CJOJQJ5CJOJQJCJOJPJQJCJPJCJOJPJQJ0$'-@4::11 $$Ifa$$If$$IfTs4ֈn 5 "`2064+4 sa-2fgh:88$$IfTs4ֈn 5 " 2064+4 sa$If$').7 $$Ifa$78\ehnA;;22 $$Ifa$$If$$If:^ֈ | % D0644 :ans=$$If:ֈ | % D0644 :a$If!"4$$If:ֈ | % D0644 :a$If $$Ifa$"=EHMRb $$Ifa$$IfbcC==44 $$Ifa$$If$$If:ֈ | % D0644 :ac!'QRg~:PV\!EFVkq} 56\pv4GOz{.K CJPJ^JCJPJCJOJPJQJ]=$$If:ֈ | % D0644 :a$If4$$If:ֈ | % D0644 :a$If $$Ifa$Q $$Ifa$$IfQRgpsyC==44 $$Ifa$$If$$If:ֈ | % D0644 :ay~=$$If:ֈ | % D0644 :a$If4$$If:ֈ | % D0644 :a$If $$Ifa$:AEKP $$Ifa$$IfC==44 $$Ifa$$If$$If:ֈ | % D0644 :a=$$If:ֈ | % D0644 :a$If EF4$$If:ֈ | % D0644 :a$If $$Ifa$FV^afk $$Ifa$$IfC==44 $$Ifa$$If$$If:ֈ | % D0644 :a56\c=$$If:ֈ | % D0644 :a$Ifcfkp4`$$If:ֈ | % D0644 :a$If $$Ifa$ $$Ifa$$If')/C==44 $$Ifa$$If$$If:ֈ | % D0644 :a/4z{=$$If:ֈ | % D0644 :a$If4$$If:ֈ | % D0644 :a$If $$Ifa$ $$Ifa$$If!$)Ch==44 $$Ifa$$If$$If:ֈ | % D0644 :a).KL`i=4$$If:ֈ | % D0644 :a$IfKL`x @V\cef&,356Wlry{| $+-.Ocio67Ia~9Q CJPJ^JCJOJPJQJCJPJ]imsx4 $$If:ֈ | % D0644 :a$If $$Ifa$  $$Ifa$$If@HKQC(==44 $$Ifa$$If$$If:ֈ | % D0644 :aQVef=$$$If:ֈ | % D0644 :a$If4$$If:ֈ | % D0644 :a$If $$Ifa$ $$Ifa$$If!C==44 $$Ifa$$If$$If:ֈ | % D0644 :a!&56W_=$$If:ֈ | % D0644 :a$If_bgl{|4$$If:ֈ | % D0644 :a$If $$Ifa$| $$Ifa$$IfC==44 $$Ifa$$If$$If:ֈ | % D0644 :a =$$If:ֈ | % D0644 :a$If-.4$$If:ֈ | % D0644 :a$If $$Ifa$.OVY^c $$Ifa$$IfC ==44 $$Ifa$$If$$If:ֈ | % D0644 :a67IT= $$If:ֈ | % D0644 :a$IfTW\a~4$$If:ֈ | % D0644 :a$If $$Ifa$ $$Ifa$$IfCt==44 $$Ifa$$If$$If:ֈ | % D0644 :a9D=$$If:ֈ | % D0644 :a$IfDGLQ4$$$If:ֈ | % D0644 :a$If $$Ifa$ $$Ifa$$IfC==44 $$Ifa$$If$$If:ֈ | % D0644 :aUVu~=$$If:ֈ | % D0644 :a$IfUVu-BLRTUtHI]r}(.6DEYnt{"#$%.x~6OJPJQJ] OJPJQJ6PJPJ5PJ >*CJPJCJOJPJQJCJPJ CJPJ^JCJOJPJQJK~4$$If:ֈ | % D0644 :a$If $$Ifa$-58=BT $$Ifa$$IfTUt}C4==44 $$Ifa$$If$$If:ֈ | % D0644 :a=$$If:ֈ | % D0644 :a$IfHI4$$If:ֈ | % D0644 :a$If $$Ifa$I]ehmr $$Ifa$$If#Cl==44 $$Ifa$$If$$If:ֈ | % D0644 :a#(DEYa=$$If:ֈ | % D0644 :a$Ifadin4$$If:ֈ | % D0644 :a$If $$Ifa$ $$Ifa$$IfC==44 $$Ifa$$If$$If:ֈ | % D0644 :a=X$$If:ֈ | % D0644 :a$If"#4$$If:ֈ | % D0644 :a$If $$Ifa$#$% $$Ifa$>]> !":^{|=Zu+H Nhi-@\o"If|34MWst'@TqCJPJCJOJPJQJPJ6OJPJQJ]6H*OJPJQJ]VA;2;2 $$Ifa$$If$$Ifs^ֈGh1"0644 sa 3h$$Ifs4ֈGh1"``0644 sa$If $$Ifa$  !3d$$Ifs4ֈGh1"  0644 sa $$Ifa$$If!"#+.39 $$Ifa$$If9:^ampB<3<3 $$Ifa$$If$$Ifs4ֈGh1"  0644 sapuz{|}3h$$Ifs4ֈGh1"``0644 sa$If $$Ifa$}34$$Ifs4ֈGh1"  0644 sa $$Ifa$$If $$Ifa$$IfC=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa=@4$$IfsֈGh1"0644 sa$If $$Ifa$@KNSYZ4$$IfsֈGh1"0644 sa $$Ifa$$IfZux $$Ifa$$IfC=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa4$$IfsֈGh1"0644 sa$If $$Ifa$4\$$IfsֈGh1"0644 sa $$Ifa$$If+.9<AG $$Ifa$$IfGHC`=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa4$$IfsֈGh1"0644 sa$If $$Ifa$3l$$Ifs4ֈGh1"``0644 sa $$Ifa$$If $$Ifa$$IfBd<3<3 $$Ifa$$If$$Ifs4ֈGh1"  0644 sa NQ3l$$Ifs4ֈGh1"  0644 sa$If $$Ifa$QZ\bgh3l$$Ifs4ֈGh1"``0644 sa $$Ifa$$Ifhijux} $$Ifa$$IfB<3<3 $$Ifa$$If$$Ifs4ֈGh1"  0644 sa4$$IfsֈGh1"0644 sa$If $$Ifa$4$$IfsֈGh1"0644 sa $$Ifa$$If!&, $$Ifa$$If,-@DLOC=4=4 $$Ifa$$If$$IfsֈGh1"0644 saOU[\or4$$IfsֈGh1"0644 sa$If $$Ifa$rz}4$$IfsֈGh1"0644 sa $$Ifa$$If $$Ifa$$IfC=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa 4$$IfsֈGh1"0644 sa$If $$Ifa$ !"4$$IfsֈGh1"0644 sa $$Ifa$$If"ILWZ_e $$Ifa$$Ifef|C=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa4@$$IfsֈGh1"0644 sa$If $$Ifa$4$$IfsֈGh1"0644 sa $$Ifa$$If  $$Ifa$$If$'C=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa',23453h$$Ifs4ֈGh1"``0644 sa$If $$Ifa$5>@FLM3$$Ifs4ֈGh1"  0644 sa $$Ifa$$IfMWZcflr $$Ifa$$Ifrstu}Bd<3<3 $$Ifa$$If$$Ifs4ֈGh1"``0644 sa3$$Ifs4ֈGh1"  0644 sa$If $$Ifa$4$$IfsֈGh1"0644 sa $$Ifa$$If $$Ifa$$IfC=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa '*4$$IfsֈGh1"0644 sa$If $$Ifa$*249?@4$$IfsֈGh1"0644 sa $$Ifa$$If@TWbejp $$Ifa$$IfpqC=4=4 $$Ifa$$If$$IfsֈGh1"0644 sa4$$IfsֈGh1"0644 sa$If $$Ifa$4$$IfsֈGh1"0644 sa $$Ifa$$If:Se -3:<=Odjqst /EKRTU* CJPJ^J6H*OJPJQJ]6OJPJQJ] OJPJQJPJ5PJ >*CJPJCJOJPJQJCJOJPJQJCJPJI  $$Ifa$$If:<DFC=4=4 $$Ifa$$If$$IfsֈGh1"0644 saFLRSeh4$$IfsֈGh1"0644 sa$If $$Ifa$hpsx~3d$$Ifs4ֈGh1"``0644 sa $$Ifa$$If $$Ifa$$IfB@@>@8>]>$$Ifs4ֈGh1"  0644 sa $$Ifa$  #(A;;22 $$Ifa$$If$$Ifs^ֈ ~E% $0644 sa(-<=OW=$$Ifsֈ ~E% $0644 sa$IfWZ_dst4$$Ifsֈ ~E% $0644 sa$If $$Ifa$t $$Ifa$$IfC==44 $$Ifa$$If$$Ifsֈ ~E% $0644 sa=$$Ifsֈ ~E% $0644 sa$If 4$$Ifsֈ ~E% $0644 sa$If $$Ifa$/7:@ET $$Ifa$$IfTUC@==44 $$Ifa$$If$$Ifsֈ ~E% $0644 sa=d$$Ifsֈ ~E% $0644 sa$If4$$Ifsֈ ~E% $0644 sa$If $$Ifa$ %*i $$Ifa$$If*06ij(;CEFh}$8UVx "<^wù6H*OJPJQJ]6OJPJQJ] OJPJQJ >*CJPJPJ5PJ>*CJOJPJQJ>*CJOJPJQJCJPJ CJPJ^JCJOJPJQJDijC0==44 $$Ifa$$If$$Ifsֈ ~E% $0644 sa=$$Ifsֈ ~E% $0644 sa$If4($$Ifsֈ ~E% $0644 sa$If $$Ifa$#(E $$Ifa$$IfEFhpsxCT==44 $$Ifa$$If$$Ifsֈ ~E% $0644 sax}=$$Ifsֈ ~E% $0644 sa$If4P$$Ifsֈ ~E% $0644 sa$If $$Ifa$$,.38U $$Ifa$$IfUVxCh==44 $$Ifa$$If$$Ifsֈ ~E% $0644 sa=$$Ifsֈ ~E% $0644 sa$If4$$Ifsֈ ~E% $0644 sa$If $$Ifa$  $$Ifa$>]> "$-/=7.7. $$Ifa$$If$$Ifs^ֈ~S0644 s4a0/5;<^a0$$Ifsֈ~S0644 s4a0$If $$Ifa$aikpvw0$$Ifsֈ~S0644 s4a0 $$Ifa$$Ifw $$Ifa$$If?9090 $$Ifa$$If$$Ifsֈ~S0644 s4a0.h$$Ifs4ֈ~S``0644 s4a0$If $$Ifa$12IJef $9STk~67Ni1Jdt2Daw 5LiA\]x !:PlmCJPJCJOJPJQJ`.d$$Ifs4ֈ~S  0644 s4a0 $$Ifa$$If $$Ifa$$If#%=7.7. $$Ifa$$If$$Ifs4ֈ~S  0644 s4a0%*0123.`$$Ifs4ֈ~S``0644 s4a0$If $$Ifa$3;=BHI.p$$Ifs4ֈ~S  0644 s4a0 $$Ifa$$IfIJKVY^d $$Ifa$$Ifdefgpr=h7.7. $$Ifa$$If$$Ifs4ֈ~S  0644 s4a0rx~.$$Ifs4ֈ~S  0644 s4a0$If $$Ifa$.p$$Ifs4ֈ~S``0644 s4a0 $$Ifa$$If $$Ifa$$If=7.7. $$Ifa$$If$$Ifs4ֈ~S  0644 s4a0 .l$$Ifs4ֈ~S``0644 s4a0$If $$Ifa$ #$.$$Ifs4ֈ~S  0644 s4a0 $$Ifa$$If$9;DGLR $$Ifa$$IfRSTU]_=`7.7. $$Ifa$$If$$Ifs4ֈ~S``0644 s4a0_djk~.$$Ifs4ֈ~S  0644 s4a0$If $$Ifa$0$$Ifsֈ~S0644 s4a0 $$Ifa$$If $$Ifa$$If=d7.7. $$Ifa$$If$$Ifs4ֈ~S``0644 s4a0.`$$Ifs4ֈ~S  0644 s4a0$If $$Ifa$.$$Ifs4ֈ~S  0644 s4a0 $$Ifa$$If'*/5 $$Ifa$$If5678@B=`7.7. $$Ifa$$If$$Ifs4ֈ~S``0644 s4a0BGMNil.$$Ifs4ֈ~S  0644 s4a0$If $$Ifa$lux~0$$Ifsֈ~S0644 s4a0 $$Ifa$$If $$Ifa$$If?9090 $$Ifa$$If$$Ifsֈ~S0644 s4a0.p$$Ifs4ֈ~S``0644 s4a0$If $$Ifa$.$$Ifs4ֈ~S  0644 s4a0 $$Ifa$$If"%*0 $$Ifa$$If01JMUX?9090 $$Ifa$$If$$Ifsֈ~S0644 s4a0X]cdtw0$$Ifsֈ~S0644 s4a0$If $$Ifa$w0$$Ifsֈ~S0644 s4a0 $$Ifa$$If $$Ifa$$If?9090 $$Ifa$$If$$Ifsֈ~S0644 s4a0.h$$Ifs4ֈ~S``0644 s4a0$If $$Ifa$  .h$$Ifs4ֈ~S  0644 s4a0 $$Ifa$$If#%+1 $$Ifa$$If12DGRU=7.7. $$Ifa$$If$$Ifs4ֈ~S  0644 s4a0UZ`awz0$$Ifsֈ~S0644 s4a0$If $$Ifa$z.`$$Ifs4ֈ~S``0644 s4a0 $$Ifa$$If $$Ifa$$If=d7.7. $$Ifa$$If$$Ifs4ֈ~S  0644 s4a0.$$Ifs4ֈ~S  0644 s4a0$If $$Ifa$.p$$Ifs4ֈ~S``0644 s4a0 $$Ifa$$If  $$Ifa$$If  &)=7.7. $$Ifa$$If$$Ifs4ֈ~S  0644 s4a0).45LO0$$Ifsֈ~S0644 s4a0$If $$Ifa$OZ]bhi0$$Ifsֈ~S0644 s4a0 $$Ifa$$Ifi $$Ifa$$If?9090 $$Ifa$$If$$Ifsֈ~S0644 s4a00($$Ifsֈ~S0644 s4a0$If $$Ifa$ 0$$$Ifsֈ~S0644 s4a0 $$Ifa$$IfADMPU[ $$Ifa$$If[\]^hl=p7.7. $$Ifa$$If$$Ifs4ֈ~S``0644 s4a0lqwx.$$$Ifs4ֈ~S  0644 s4a0$If $$Ifa$0$$Ifsֈ~S0644 s4a0 $$Ifa$$If $$Ifa$$If ?9090 $$Ifa$$If$$Ifsֈ~S0644 s4a0 !".h$$Ifs4ֈ~S``0644 s4a0$If $$Ifa$"+-39:.$$Ifs4ֈ~S  0644 s4a0 $$Ifa$$If:PS\`ek $$Ifa$$Ifklmnvy=d7.7. $$Ifa$$If$$Ifs4ֈ~S``0644 s4a0y~.$$Ifs4ֈ~S  0644 s4a0$If $$Ifa$ *st\ ] ^ _ e f g h i k l r s u v w z { ⳬ⦛Ↄ{{0JmHnHu0J j0JU j]BPJU j>PJUjxf>*CJPJU >*CJPJ j*)PJUj9OA CJUV j PJU j$CPJUjv@ CJUVmHnHu jPJUPJ5PJCJOJPJQJCJPJCJOJPJQJ.0$$Ifsֈ~S0644 s4a0 $$Ifa$$If $$Ifa$$If?9090 $$Ifa$$If$$Ifsֈ~S0644 s4a0 !r0..$$Ifsֈ~S0644 s4a0$If $$Ifa$rs\   J^ `J]\ ] ^ i j k w x y z { &`#$] / =!'"#$%$$If:^N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :a$$If:N :$.  !$ &06<<<<44 :aDd(l B  S A? bpfn'.LhCnDfn'.PNG    !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~oRoot Entry F/y|Data fWordDocument`ObjectPoolPĪy|/y|_1088858230  FPĪy|P5y|1TableCompObjhObjInfo [$@$NormalmH <A@<Default Paragraph Font  l,b$o^sOL @n(   )49. 6   AB S  ? t@@GzTimes New Roman5Symbol3& zArial"1hg&g&!0 Martin Tompa Martin Tompa   FMicrosoft Word Picture MSWordDocWord.Picture.89q  FMicrosoft Word Picture MSWordDocWord.Picture.89qOh+'0 ,8L \ObjectPool PĪy|PĪy|WordDocumentjSummaryInformation( ^DocumentSummaryInformation8f      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]_`abcdeghijklmpqrstuvwxyz{|}~q bjbjt+t+ jAA] UUUUWWWWWW$F:Z{U3"UUU{UMUUUUUUUUUUU EB1UU  jUmHN N!"# $ %nDo^sOPNG  IHDR(lDgAMA pHYs'Sm IDATxK$IRfY~Mϴv4 H{o@bŝ+7 Cp $0jٝgDxddUuOdO6Jiifnn)%סv6̍#&LB̨Vd!,WD>:Ư79fC]CkP^eث.{SOIF eť%IBl@sd:Vwznmھ<[e*yI~Jh&&bLm.-놀;!hIFwu.&1b4wXc#}.+8)` 2T`U6˞A-aꮉ6IWFuĈ/[\I*drJ8%Mu!QLX/ްPdtv2@-zUY&fh_lmG#F=hO*&$ pUmTH0!9jqTf!VcATż:qc^^0T% Zɜe-ۦ#3)8*6)~Mj!"yjYTn+4{49.8cb0{vy˼;l'e~{Ye'$fJ%Iq&c9 UJ4挫,$n`Nz /N)IeGj<8?{PU݋nmvg>k?svv?xIUK=b@bpj8{V> +(E bS^>JdD\ &\$E1k/Hyc(ՌBrgϛnzĈ/Z!+A3E 8ߛe?WZ*Bޜ"a/[.e~r֐v'_jFlZjumq=6P>~)( !5 OqttDuӳ7 1hBwI dpJ)!<` eŊJ'^-$U0GCvlݳ#SmU:ĐQb :+$O2U֬y 8m㵁;ڜ1L{@o>];*!#s}/uMX.$gfˊ<(([y_7Ц9bqoqsMёG~4槵,AQ0=v#%YB,4|+B'ʿDhzǭ-MF~I%u kF_Z#cMy^9\~])d!dHpo(N}|{͑GnFWdK$.YJ<3ud='RU eE=nH.]|b`uVfo s/*I'CHe~p#FtFN6JF# ’*5nV k09gັJ%H&Cd/WHB($)., *uFч*s07xmh`rsudkxɝ㋅QRpÛ &i 3¤])_90{oO_G :GigX.'O'yz59=99;|yq`F=l:%buZ'x|'M&|0_=1BZ `?v7}Ժ?C^o .@M n.oC[]B|atZb`$NnV,q#"WJSØq(Av?TJŻH ۡmmږT0gw݀/L(wΊ&ݗ(KtըM+7vCK 'w"F!DP22zN$۩j)u'Te_4n{~tQGqy}G(wˊA?$ϱ1@M&a ~+ W!L$KB=d+1\ 365(l%t/~nzw[1WÚvAs#?!ݗ oJ7b.߯Az,/q G2 *u|흪Ku=)br5B6Swx;BWO_b/qg̺o0Td+Id~M ZHZ<2 տA8&մ+4643 H!ğ_;ڤyP]7UKLb6iZJDS#"JfݒqirӫzՋ%C3hڼuLFM9֛$lMN4ҫ%*|[YNOϛ; P!Q, Ցpbڥr5I5!A4]̞fŋȟ֫+ΥGszNwg=c fB W@l !;KO쐌dgGd{odTuNGy:Uu#2{:5xgsxmSS9TP>z!GA̎<D_N/Q<)@_rPz<>>'9cۀh^FaEP5L.ie8梄D;>kOdu1Hp꺛̚tHs͆_' k̚5M?k_;Ϯ?%3'&c릐\w.K6vAleA Qΰޥ Kou,H@X,g+"}$꾚8$+Sbz}^Yg3+gS ns>Pô.R哥_zmm'YWO||oųiaeu&|2U_+ĺ}5-Yv뮩XUeNoV /hp(Ԋ<0:܌c׿Od}(=_k J?.n|n⽕i_?K<9 Hh-"A8[UZ ^j?'U5@$تasl{ٵ2.;"6W(8/biꘟ|6wxz tU@2ZBBiR@GlGe*kty-Χߜ?=avv u3gw6"we(v[rI[c"L[WV%C$HȇHHIA*X b4w9:F:ɳW*vT̜^umM"&HK_YE }rNV{<8 %/*PVW w?íoځ^?E t`%B,8lTqmg -}OGrQtӄd[тP5\-Vu5,F{cƂAUS.O~FM”GB DDKH<BmkųZWa8^?:]`g<%* IQԕhJp@چ>b hMd jy6\I~ٹOOOggڴ%UciYO^DU[5^ցZr_EXOS"&mEm?7oSЩ Zv1Lp|M^Ϲa&0'm qJkT lO>,k1ƨbZd_VYIn횺I_/cԈk$Y TzMFjiL328)ȹn? ZŧdLa$2p9;ȧBlln4juUc )v~eյԏ?:;9_lz[io6Pn6K(H Y_RȤTT5 ?DE9WMQ#eo ҦCPՌ"PH,P伶uU- [ˋw�;aAeowFܨl$BC,'jp?o(ґW,iZC #cR`jSfGwEh]S7N @/D0zf o $ ?ӓ{|5i;k̄mטQ`Q0HjzAhV{: |wT>{ftU^M KRu(<zl ˧>;ǟO}%2Z"c2ܔ8z=+>TS#Pfptk,jSQ|c"s*/6@[cB0` p'}ÔHGAA}sX$%^z J)f.r%XyNLɢ DKl d3r$}+Mu'T:Aj2!WPcμb"pEh _Q|טQb %tXS*fZ>]V*P:lu==}$ lMpv]CJZla IװpUPfěL0S=HwvYWݤjq B`ԜYS䄌d5,9ՁC\feO3_󶺜)뽦'lDžԴ¦LB․F|rw 9RFeM׊Gzqj*L > "$#;O=i* 6jjdlD1p~=oI,I9WU#bME L{ڹ*!PgU;~$9T4wC`Mjc4|SN M6r%_#v߸etuzg 1"C]jLk4 c0L#egQ՜gc u)k~7L !H`"{/J0tBf(LT,d׆R*6`RFV}_[1!{%A}}urtfQ 0_iyVRP0#_yR)7Ϥ.E^~Yš.֏bu TJ6Rf4 J &hɯ"aYWb[vVO}~rzt݃8nZO!p2oH)ї({́n|C Qga!8o)Bţ ͦԈσjjzULT['M[@ڸ gK :Ё^HjD'oS8nGgF֋)^b56*,Wǜg8jJþ:IIO!~g?7ӯ.C/No*=Ёr,.Nxm>x> 2xB&ߏ8Hɧ{}w޽wc9 髢p 5C 1~:qyW030&V܆1SumNVУGJԼI\λ9Dr0@s 7:Я@p Z zIieE)ZN^/)nt_4G3z/~Mq6Σ-bq+n(@@B޷E%,/uV kGbv_A TIf$ҷl@G5"읻%YR[~<ݕpJ``@BBZaHКH g106HV+ 3CLNWWݪ{ztwUwt1By9U/8'"_!ckBD{Px]VB\ @STABZL9k/!A[eM$m܁yS^DYeX J(e_ `\K4?<[^W;I3;u6F.!UQz LvwإY/Grד80>ט֌7`RjWf}Ov,a˝(6ئV3j?3pYѿlt  boW[ uyrx8 9iSrהou铀`֧څu=a'〧{"!gw'V%ig:Aŵ۷yK;/b>Yt]|[Of+[<,#K6M5 ` fj@`6" G#SԤ9]ZТ&#kxU ZֱK L)YndPߌ>7ꕢg97-@ZYα)$48pXz}{ŵoТ.ugɓe*AEytÃgs}!RY+ZL6_hv⁸4&`JmbzM'M_]pgO>َ.rp m~N6g(g~1A3f\ QH{ Vi*=خ}h$oS<=w>#>'1M@)6dI_VU0lΞ^2r&V[3  $ʼn,X\4 5R4Ȑ0vƌ$ b*A^"Vy6JM[\rҘn]ZO %G[˖T L($|HJ4 Njw>$2I3^3J'VBjIFh(lP/^NmTt)Yڑl[.yDž!J/'1;1%/2Dbج=MD9Fh(ΘFXi|TFBmc9 _y:L1-/v$kujIc6#y[Ibʴ{Рg̘ӓty/|(G?iV,`1qTl֫@tv$hD e4m؞AZUAL(ES$$A]tNXiuٱ9˂CewWx@X T PLM GxeA̒<8޸U8w5u)bIfmۇ+>8va$'E"ii=I1ƘDgG%8R#]K 3$yKP"x޴Rf?/5hwnS%l kjS4<#o`[P+Roƌ7nNVْ"٨CwBM6,ݩυ3 LiX wmAF$lĒmTRmwd+e/!ҏv9a88cƛjwII%`tnXWh~vWPcQXL5_N6L$Ok ]i i/Gʀ°.g& !ۧ, u t m1/SjA#\"Ѩ{(mtemA''!gO޹@NEbFz; P(=oiku26ˇ@ þPTa4D$bP^M-cFlPC#B@:tfI9_ǟ~;>~M `UC*jF߄jK~Z(ntm,{E$Tw̥I{zVթ'z>4a o|C %@o0OC_u:ING' ph[\wufcփڒbބaAwm{02gG ! BoZm_6쩍_gq>zqT3f\f-6$$!Dß1Ɇj`92ÈǼKs ζ (y-/ij^qx0>wnwCHF3s`*犾s_%XgJ}(ix??}[ szͩ<^̈L=G1[N_]lh mQ'd^|,ՠ{9~ujv9,ieA+a_SO>zY*9}#FBS4QcrdW漚3Fjh4J }쳅twѕ.a4| ڋSV :޹g|v\3hM #-mLv:m2U8MvS`ڱ"F r~*U Rk-MYq9O䝘 H].IIh YvoBd.D(K2bzxP4`{X/K8_Zu1cj)yȓ 9>;uC+qt{ ISi7*=r$B\n{#IYxDddVuUkgg`Gbą>Hˍ#\\|E;'_#r]3;ʌȌڎT ̰ |.){{2:N h:4ФMD3:߽l|}RX,$>|t [!@_*g&dzzgTik~&{7sO$׏1Rveq_mFc::2yΓ]~);)E~r|_'Ckx%%,+v~~~PZmknr4_kMzP|䓏xt~߹՛ݩχe;PsB,M-_{kO?iJiPp3PW,WS)t-`Hva6bY9}Q9/{#>VY֓vxd.E@.OOÊpb-á[Q7'm;L'I ɭ\7s62lyS]FH%|tz㏤ EOp,kba[07Zi[kU-߹{|Ċed3.0wpPgc[2JԼٟ4&(jñNU&ؾ.y(9XOZr|I]yHxWu#[A?ؽ=Zx½S OHnujMǠpA ڴX'䀍ڵuKuC^̫(KJlYRΧ,+~%n>yC=Ǩdt7C+#̯MHQND=`Kh4oi//T =8 d$Wb~w+)x45e/Iݑf:Y֜ZTdX9+Cp.0?y!eQ~g+?y}gU_ 1q%EV*zfc9Ah 3D'c';ooC6"!ީHKpbK\[?^g9><=r'+۳Ͽo=/ih^GH\-5+-m]xm1k{?o?MKc_>:N^ܧٺt@L y*HC~Ћ1{z)9.9|p@~!SR=iYM \s NQEG9BZd=#?r/EDu%^ G4F!#EŪm幢r Bs BhAE2<6tio{ݒPc5Z{ZR;rS>kRBCVYւx(f8D5_ Zw-j誩g|\T!Gԩ@Ӌi9 qnc%#QהsLd_^wY{Ϊ7;/N5*KX:xC҇&dkN,WjV*Suofhg-vJfar);&@L1[ĢCѣGoYZj:#y|kbΘI8z3B bR"pb}ͨ6΢FxW|5ӓeuEaf]^Yx8C*ŅNAP%X]*)Iv|Rb M1?YRWDe63{Dq-,4Bs #=kR1=,M)̕2 T!fM &t8`p84)>? l8Fl]3n::ܚaR=&5(~b:<Gд,|je `H4Q*H0< *('7cMYtR!~]3 i%Ue><TS:H=6a;ַ4Wz5k!ӿj~[R#+Ed98xzKy|Zo Ԃ ytk:--_@S`/Rzt*ט% Z%k:%׀MF3v&OڙT{>W<[fE(:gF5oL!3sZad5¦=*}yA0Iuۿ@GK3?U.y^z]ɳm뚒`X)@; ɮ-0JH3И{*_tϵFM2L=K5!VtC %iC&qM8-f磀$[[mCb'v߇$ﻦxG4u:<ٱ+HHU[0gp0 Ef wKT?兵 o䣣Czn<)#}AtH+yT{QqW3Y`ly\^V@ƴkH=0<,hzaz)ngBAf4 6[ v(ϞO;\}dő&q)#^ x6CW%,t]h}Y7uYqJ ! _zT#@%-3LGāZXA^qZ{7~..l *e8K0绮sm󃈴n˲K|D@,}6A jh ) /702,M)F=gA/~z.yK>l{4!)T/顅PS*7i:)q,/ \. DVps psy ERt MF`U jg4ps}I+j/msӧOjv8F[U5ن5h,t,qG4jkچd d:;[WXiSȟ1x'|@־?^ۭ _O˃AJ顇vҍr)@ l;D,{|}Bq OH; |c`a$x-]t|kn7O O>o=[CQi ׸VLU&!3@&5zjkVR=Wz V` Z#5aD1gh5 .@_\~fyb+;}1EٱGCNM!aOl377ɡî ɏܸd;D=w`0_Rà,R&' IDATa Չ&ڝBXqAkE n"oY)v`G-ݎK=\G@0U z'X S_"7MoEh{1I%<ܾ)^RFjqo t]hGNPAQ [zEggߙ[G{Ĺ;4ht 8pޗ89n+T}/ZP!(e4J 򋯮3N4+t*bcyd 1K6qO0!0/o-yOl:O oJ1 xDNҀ^Nɶ &'+n BVPB$9T&DScO?E2g2ӖZ.6'Lh2[/wy74+%"l nAcƃF(f  ޺Kw gEՄ& h\<렁fx(O95+7%W24L|7P`+ňjEИ3Ҳ/Y+־mKA_X xN(=҉>\6@RMPڤͪ I:-fEw W+TT{[ش{&yƱH>DsjFb#$ÉtϮ_TswuƓ;o֊YITsZhF LEޫJg1!p?;;=:8( 8h2{([$XbCy!VR "q4Ur0`I\JCOu8v&Y)E( %#7O,WTF٠0cu.eYprX!Vsϟ8>MhVn&<0πwQNQEF=!6aMGo(A~t.D; Zl:1}tX3D@nnz 3N!q]8 J].-o<`vV/^?xW~_<߼Y?ԼA&4$~f-=w8Gy}~^ݺM/C T\t NZ~+ȥ6y&zerNt5\_fjʬߔ{F7͞bJףsiN263H,6ax ҧkDhR氱q(au˒h:ʊ@r% 'lzݙTV/jT̃QNE6$tT-I7Q&&rƙ *"kʔ}ijJnOəuKnkh 3v H.ZOpK᎐9jbƁ$g7lND31B6 нpKWe/J6p]}̓JCQRSΪinSf fPОRIQfHK܍z57}bb$m9+i!ك9᜺J~;PmyL7 z:XO (P ~4ܟxjj*I]@h)@,غ^j̫!t ŗU_u˶KsBպ]mu?_:U_.`E^몚]?9Rç>΃RN*VÃ[%4+V^(΁^uWm5/5+E C .A&u>Npہ [ݜ 弄pzWC8p(A9=}jV{ڑ{2n)g':mBng v!D \%APGBV޹Heewνzk{ @BaJ"p0a`h,ݙizg*2uƍWgugzS(VTĭ{yL&j~+kVM76ru0&D|G!rKd/$inVoZq{+Ҡ^s=>|F^KCbj pu kSla,b;?{bڽ hvWH jvYS%0bj./]֜Ib[?ʭF44'<{烗Gql"p2Wj ^4;MJZV&u+rֽWZ44L䟿wd,-oi1kg Hg_A&iu{Z錬.ы 6HA9{%Pݎ[T/_8wCoY|{9iWrĈX%s$* bo5n5 6YF'eᦍR(+Z. <kʚ(lga 9MR#In4moA4 \DBYmGIxb5kHtiA P1%$uCZVE]V<-rd CR!t+&P[PJ"[S4bīUyRv٧BjIFP@Y:! nPZ{]mV{O uҙml|J^ԥx[hS@ r[oJPe+7.MX+2F0x;d3jhA31L*sEl/̝l$ރ'@<o#Fln:>'>kfN` PAXBR@Nv5 PMp)4OS$s8d!x޽L`R9R:thR`&s.ۧ,u tqVPjA5(w#@eY .+LiJ#-\oy m8ٛgBRB-i i:x02a**Q:Vu\2؏ e9I>{7)LxYI$xC% kA گu0(o~տ_˰`ogjB70 xnzzFlM TmrCixpz *1У!ML {ׯ 8WWO9`F9["hqߧby{u$ @0he[Gq腋˰ Ʌ$ E,79bĻF]د%FҬD,֜ݲFY@-`p;{nXے=bĖab!~6?šȢ*lBngN@/`ۄ׶[: a=0F/,l}#Fl *'$X@vI)ٟHP֭H4Ȋ[259UIg֒˺pG9["ה3u@NobڮoXFJ T>9:e{PN'Gө>6 c(oO|9 'IE$gڢ]-ʹ[2x0I>zrt\oO2!1sv;q'Sf'/݁tA *Œ.jB9<9{l=??{>;GtDEjH1vmHUTϋӻկy~4cу䋧CgM+M%$ ԮldȪǏ?_yy?8;ezo[A a J=Ԅ?F gp !cY'jtO]+2/OH=B5nb'̟_<}w?S`*`[roSV>ǧwL?y<=ğ5/dvԸf!uԍ?3-s$;/"O>,  !$ 2{KBA2[ XH52=g꺏<7oWcWO=*uy2Keĉs"珢riJx/<~~ۯtzW ]Ğ)n|yu_ ^<~=^2y Kۜ1ƒG۬(f`Cs:~Np}:.ؓ ϩЬA(7 1^ ~|::o ^ ﾿} a5G톢JTK 'b#/Ot_%BkfA'ۦg"Bc@Ո$'y $72%h Yנ3踇"D(6-'coefVrV@&AކB}m,EvUx=(Lr*Ք?vOgfۄf~tDoG@ܹ)Ԉi4eQhgVsGّ,υ ^AP%76?&.񰢺x(2l+= l (x6\n0 }AH#(09rA<؊F!b M$'*dړlb}J$}uB:͏5޹<\t鮎C?џ13am(qF"fJZFtwIC-tua}sϴn<6I9c?, uz͌N%E8;\ٱ4D?H7n{E_X5=ZzNr*3. E6l!PB2;xHh r*cxvdR'LfxJ=ǖf[k[ٞ33:Ǵ) m?N4_\$oYa٥1K#Y?gxitKS YmN i}ٛ‚ܡ IDAT^ tCL =@(VP˜l#;їϑu^1=:v7~7YŶ_|?9 @@<#AbRa ?pQ5}|B,Y+ˣy\ݻƇ[y V*4ibZ4D MQi=EpꉭN޵\3=nV8a­CGc+dv35}1X&S G@Pw8kvvqޝo :&~Z v r~%BqQ{(ۚLYPU2ݓE׾Z,u(cRC ]pb$'yp-Ŏ*t\F G@Zw+DFh_F?S=,xDə(i$nzQ$V$byIN Mm'9ۖҠ* Hzw?8]չ3nwJKWH\WΩs._Ey IAMeKVg+EĹj8LNp-$ q#vڶ~ ejvMx[orl"\*ϫ`" %-wѯ$INV |$V]{yӣ(:XoWeE+އ mEfQb{g$oN<mf2@9Du &.2ʴy2H X흪RسZ.Z} ނ WMbO*8rs YRl7,{\~u:sj6]}LS7ҋhτFP(Qi3bSsM#>e'XXTɳͶ3,#4rA@^c~}Јh&ݴwE&.h|6ܱ*U&S9#U$ȤfCʋ;EHզpH6oc "eYlbiA0*h/b„WGA#P$Sݲ~(w]’pb}JlG./G0B(JC`.*337 a;7(WKeQs {>$?GRirJ,Q(BVQ6984wMiab g2fTSyXֿepYV<~mSD6y˶ l0a-#EEQ=C vM^Pm1"Sv„WcuI؟ZQO> .IOPn<{// = trJ!22 V'X9p%氲c^!Xv^g3σLO(^b2WyCIƎxdq׋MNDXyM҄-qOGINVe~ٓpL#;|FpۺY^}5z1O+ Fy@2o0MNP~# YYIjw_(G Q|W|ooy`ǽ#,ii@R/(hauz%ːֱT+W$@ (P~x>mƗ$,i-jQVP+yGЎ<兔>vn&wGbg2\Mr!DҢۮj m*J_`~5~h*/r_GĊ]`"#t F<S3`pW%m $oQ WCRT4-׊Ub]-y{5SF> -`%)xȝ=Rci{}sIJDH"ǝSB :t"gV:GGf A(ވwz#(53ħ[ 3))bݿG ~e2I.hhMd d̵?$`"Rx/*yN*XRhN6 [ 䌤װ<"SfNضm2$ q+&ăԡZy'JxJ/7䏦LOѲ΂IgZ;鹥7vg,_ cjD3 vås"]PPA5Q[(<ŋONڝਜep="U F@G&9ɗԩעx *Dq3sZL.'DXEA6ɱY$Ip\ӳӻGw6\0Fc5M)1V$:j |Q^AY1y 5dZξzglq:;cytIȊc||>x;Au/ >5b31m+%tR[bnOOU5{~ч,w"Eiэ ŕ*c_G~ou/O͊Cm~܃/Q7xWM\zZ$'9E0uݯ~[W_p^>oh^XآKNPl۬ժ^)+[WS7Lh&3Y)fec %/#YStoz2Ą&"䚔>?ILFIٮ}6WJIq4Q(1 nP¶huH&gҷ ͅvz~yR&qYUN5&5ISR _L-5 1jhd`NM-gu7% 3L3M&\0޻9s1&:i7 `Q[vY\H~Eئخ;تذc!=I[ iOˣP@L5[ﺓ;!;%כ^TKZe/o,ںv+pr?l\gj<.5Mx"KAZ41m˯M5|BCl\2XHX9 h W*Eb4!7j!*A9 +}Ff !Kʆ\:( f eQQ auh2'tck- G.jɊSYLTbJY'v*'91a"~j$oak'uCy^S9,szď~?ys?u̶$pݼ[X7*3 )[e^TҦE[ŝⅿ?{˃ӋًRJc||ҿ/?&;o" 67Wi3WW^<{O?}yo/ɝԁ(L:KIz|\)sFNxP`17XG< ^rØĤ{Eel!%]^rE;ٛ*xh|Gvq<ϚbR^dԇEK rtPGwX{zpƘq%%[iKi":WAbXl/?I6.ɤmY9pQe1I?ЕQ^mC3sn)ူ<,Ϛ(TÝUTڶF1kP$y|@;^RgˏV#*Džd@r[?E$T*C5P1@ b]ty4Zz4V;c6c61χd˥r78у(fl\=n1cpw!'jYLIӍ*n6@ NXKƓ%묻_ӣ:iL귛Z)bm)G- i\ѵFd~{b7P#G45F=vVtEʮD>}\ԍo|Yod}׽VJ}Voif\>Wo=;!\ݥ\'͡Qq/R Y09JL̑CμA@$RiZR[7q]7[q]{K2Os1{ ;nfF,?U;q[.Fd `8hOTĽ^ "7ZWulXX{5+&vѷ`uo bV[/W4\ ˹d˷7X㭷ae3gWY3O~?eW֥ z^~rV2>X$⩅Jj]5f㽋Y3OYJ[UUPĔF<֌5nx39b''?=0XKƐIz1+XfG=+(`PwjGs.4a'#ެ~OџN_cУQ/9Nf0ٴv|#)35 18^|pvyQ$QdBdN(jg  ^( 4Euj=z6xVcuVMkȅd׾ w -/j<( x^K4v.!!mL/pwiۣAfm\a?\Hj,3GLZj!P.*qۣ@,+)^$^Z:HSvxW9%zigP,.*k/?47C(kohL,  c|˸5{| 4|vV=89-O?|iv-IĿ7*ɦ4vϫtNyYxv6,-HE$1b++7}JGB^r!|vT'ōnMnċ&fdjrbӟ}])dR,n7BNut`~[hN[1*bPVn(~PF8Ow9x-ڢ0e%hˮ?!`4ޕ.J^*Chw6-ԠVZ!fSF34).c=>mzF<g|__pٗGyː)KԚ2}{]Ջ>hv_O~Plz>mZ6F\3Њx r\ v1b^nf>>L\@ٖi =z Z8I&u؊FJT0N);xFӍ[گ :6b;/ZH; 6lotoyp~=|;?䒁=z|#'?%d:ӯ~̚Vd8ǧ~&W$J~'ke?cP,Kaԧt9MAp\Ȓu{z~y_ĉE  q 0g8c$9[p@2\w^Λ7?2CfUW[ּήjEdDFFFl*A10b0H?mJLJiPLJb7䷿gDfh?>GKTw9|.l& l>?-!{SΌ&SԔ&4:u0,#?RBVKXʘWsgY2PJg:`.? M?M R!O koN)4bnTɧU5R"6%(ׄ@Z`W 7~8O R޶V{v*U³p[qGG:OG-TJϖ%ʆ"q_.G ǩjPh^^=9:OAGף<) a+Ba6t}uhZ? b嫒OY>c:霝~d43G|H(HjhPu׈@ݥ?dt>в\1=lzN5u[̓;>=彷?䍯Koot$Q˞rn~ĈO lL7&D *0~8\.R͇4jFmi$2w׿kO>[oes^: 7 *7ikm6\1AgM gN1颇*=i7If岙/G| ԃ~ u!a/ew M*_C=[a q>RU;O}|\G'HIT\oދ\|U^YA"dr KݗoH͚@ZĐ.𘲑e 1;97Qa4!F0X* 0=Hq_[uiwo1È56Ieh! + lK7i}B^EZr2qIxvCPNm!c'nAzjLUdoN7$|,RMx:w* 6E3zu9}D?ÿ޶NՈ Yr0 4Pۂ άJM7$=ґ>2IXo$eFn._m" &hqPd[?Q ty\cN)MSuuE .F-fvlϦlȡہ6еTU,#P?w$IE  Ţ:uXhf IDAT#YzO@@jG0A`@dSrr*bi鸓!=M>"^'Ns>;W9-ٝޜC۰ڶBHFCKhl<*9Ӽn ٵm9auϮi^cJZSH;ib y{ uKZ֣:ґ>1|lRЙȿuO鯵5˵t,)`aZ;5g3n{ns7}J9 +춙g#F<7Pirds QB1n新IYmeE yݼnWc5J7phwCbD(0g'ОzqBX_YYHo}Fxph BagpE)&du#F<"*x:(o{ LLk[8Pv59kk9diK S.htI?1מsf;7#F<D؀@ \Qt{vWS&|״k%BpE&yӮ.nE@=M0ٍH |D&#hĈ``:INGL "]4ĚVz ]2Lʫx8#6g'3u01Vr={ls}9=- \\Lw\dkJպTG˦'@ ݐbTF:(l0K%̭vIYkxh`+.GD(AXT!U0]AN m6RJP&Z/l xI\6e]Mj 80ZUHa3\4i*i%e@7IYLB8 LOe)X)."鿡e@vdUd%]!-:wslRĘ:+(\}0ڷvbB;e՛a aYiP (&ZLTАZf1=sJ^p^>?Ƀ 1>135F{P,4g0>?C[M0 B SQ싴P.~\b4pQE.SD-<93DݤR1<ޮλQ6^+N)igi}/ [WI Wiš~VcEi;|G3>;n;Qt%[+^gz?ussݑt])I( =:m}Aa7tipmϓvm϶Bh]$(rrxt߯!MmcH_pYOx4|kn(|{qY P M ZM ݿv,. &~2s윏ׇ]#CGQ#F8 OvR  ם+SQy2]uf69v'lvloO[jHG")z_]0 3n` :GbSIg8d֚tVܩU:nXfQ Xkg5lTR-}~ ė.Q6k^}| oF6hcYIa xjtR7hM]W777mX\܄ GzBr٬.+*кl\'k}׋[N6J[v?CY{@Dcu5(oߴPV i:AzI~='ֳb3b ]qpȜ\SbW 8*Pί@ul`u.à ln0k+4Poh>}G͟1;\q"CR瓓]+n@}kptW,"DrΟCQ[ (**˞n,xuLfmv]*(1;Wn/6E x>PLI Vc\z$KqGUut7a BH,_ [o /ٳbBbf{l) BpH,#!c:Dclp(}y\|biǔ%/""<◫jun3hJS;ABX]id~QFDmrS8CG%Oy+dvt+ nw''ݚz)mWfы^g&1 af[^Tyw !zMJy؀dj&l^Ld? mgDl[ƭ@=j `xTe5-C}a֫j,(!JD?~o֪t&` asூ*;O };XKߡU9me4a3A=< JCe_J`|Wگ_ HR49⯺yЧ @XlדiŦ`H.lj)10 OC '*ݱ@U0JSs0CzY_fieweN7Hh $ y1N, OsH Dl{ O{3ٟ>Fމ1M=}x6q ?!}pRC%ޣ-eTPm|ZZ'A ѲMʩ" PݰxQLI 5K%xkO,ZsԲ~+ti023VAʃF /nR?&Si}9kfίڶms!b*{un]Y;UMNMO?{m ʤ4rdfW&,o>ŢqI=kܢC&+EQ]VMLzpW^vSG]g D+4trB^NaO | )y 7юHqnȆESF()J`>eVN:%'VD_)/dP:{Cm*T .mm.?{T4oU 3PD xw}@IU BanppMJ ]-S`ӗȻ?#:sݦ+\'at1/օ5'3IbOѷO|p|[;̍?y <C>UJ߀x ]Mk^A}<] iO% Aw?%:uHwՇNۥvb} }ϖ4s/'U 6jsSFp2HO,,W׽/>k}ۋ'9a~RËg.WT k?F'd[F(UA(n[z”^ܬ}J14]uUFy`bS ,goh`鯨{d<1 7f0-[;jX `jqP&tJ頰*Vи_ bkP7Gt8k$lvtmr?%āzMic{v@cEފ0ٚs0U5~UMK v\Vu6Pov)qBA?]kr|oIly8E܈d|ҁC`O-t3`k3c{V7lΊOz#麪G#'PaM8#HL#"l{(0ޕuVc7*k}@G{2a?06~2ͤ7Gɟٷ%[z 3C < C+7?xܺ' @_;D\'GC& #, - 4ښAы޷%v;EB`RG/?T|<қԱ:zcfgK7l[z#$_nT60M`$ͭV$]Zh$H Ho}w' xPc؅_ks.d3ڍ+NWp'fJǧvL/X's0ID(4FxA`jS17"=,' SU8EE䰜^^t>)g+ӟ<}ۿx+O֛or- B_x*C\&(HW J>^_Ż>xW}rrf2Y =ڂ_KH߈?L@S.,^;@r)6]0h)W|/MA?G=?o>|WY/>ޗ<;(ەO pi5O%F<:2j(J)8=?ݵЎzg1۔ώ,;RM3p==M̾"al# !6#0<,Y"|f ,c\OxR-;e #,P$yG*NpjmC@9S{ה>N;BCeЍڕ@G#H@;|I.?;yx UuCb}A|vy8" qH ~߄C;PZj"[<AOtMx k<0޵URM'ы qwA7@s~|:}ŌAz¿}\4OݳO&Kք%wO?.<K~N|1 qJ֫/; ~ӁLڗ ֮w쳼!"1KmJv},ӌ'HA!qt2=='y ֓=GV|xJvK@gv =lݗc/dǒEزeeK{={(e7\ B9veH4Pmww.=$I#3134;.qqB∄p~|wBf{fvz둙4Uݙ۳=W:*"3iXY^og~vfg %$McYMN10h֫;~ͼַ4"v@ݿsWݻ(=k}dcNMFn{䚷DyR,mX  ~ Z.+JPφQ+ YOP^XOvoБ:]s nDB On ] U6PբoLR+·,]d[/%y5.ɺ}ٞvJ G< nzzv-i#}eV}SlڿA$[i$}/M)%\Q\Xpg!.}s/?:0$dm6ik};_+w/VRw0kOzS>{kǯ3i +șrI K8Ba {/3CdOeNr'ݲK7t~G.>זq{?,5pSex<~$ttPWd`Z4Rg{|7gr4߫x :<)uN:'H~c~Z,U|ݟj\ vIe޿QY#E}Ճw?.`Jgm5utSDyvcFz)[+I~|||{?ϚQ1J^#}ThEb,Ϲsե-zG31PJFZfx ,=M$? I觥-eU/WW_.n9-Z1c QĂhZ׶z9=pN/ Mɏz5F|á׏:^l-{!+ ۜ@ 5{"opZ;, d! jN+7unFA#nڹtanCU+9B֫7vr$9 ^\ yfh-SXa SJhVD;-;$7b8?*'h֭o_ ip+`񸜝ݵO`\,.w,a6﫦;A`Ab> gG\qL͓`(giyc5yc59RH&Pqz)z(Έ*F#Ri$&sgd5`bv6&-Χy >MO a2 ,ěBQOTZU$Nק/Dz-uwyoD7uq t<Y 1R-4h3GB:4/݋?eŭũc6Mkx1InE/x_<5m"s/Hj$W As&6{v{FcMt x[o~[?үtpg{/Zk3ĶAGgՏަ#R@"GF]W&/^[F7޾ $v÷"u^o-ȦJz_WG:R?a@e ene) qF4 *ZbH֭=5 6|>5u"az@zl{ԀuC tCrZibĆnEo-!9= 'L$)h)m U~vjk?b'(WTO:;iӋgf,,(!*h%]R)K)!q^L\MrZ)xR=U@R%uusFфNUJ"~1:GVYbZͥu^v@cDEnJ<BU0G;ȲS򲩜;UHm|ֽ j8mGx}zV,]> 'ߟMYIu;`6VɌ,4;TM`hc x$j=9  X)uV1iS]BC MⲦBh &5'ՖX*@sdG'DS%ASvzg褎>3<1CDWbQj{%X Т,&Karj$ɕBB-ZӨ{^]=ӶbI$yGxUm-8 4iw4'8Y{:Ȧ"q"1}iCJpxO#,/'SH !HJTHaįA@n|LJ>O?gsB 2$I̞AQDn@VZǏ{iWGd|IVu$ X47bGshE"(>PK λDdg ]YBSh EQGYj8yp,,Mgs;HtTR>h 1Ҳ֏O{8aį O2V+2^r@Y>K eO>{;*,2q.2|B'{mәڒiSHPXGMsį P.H3&h`ɣG?hqS&Zڒ숰.]#Mn)PBm6ITHՠVZvBFzq#$4kW4:x#U'L#~[qA/6iaER4 nc3qe{|6âiUULж{w?Ͽ;=~Ǐ1օCRkgNz#}۩Webԡ,OwOgπ~//̲H:[m6)a  v0@lY,발kz}_!a'sX@ ,!!!`}}0;@ W1~ת[#qw*Q;%#EІ͸}S{NC0GM7c絕G߰{ (@iՒf+^o ]Ko#g'rt! 8>DGIA5@"x7̦G-Htq,ZXN fejA6:*ml-~}$O0mE/ ^C{#ז1Ww5`C @/B?=998m·ݾ7Q$#5mzorB6ΊW9Y^0 Ng2#D d$ HŊx ruR/&~O>=?w'>x׿uzz_߹pJZ`IDž#daul&__~|}s{Y.~9P(X&l;s#F|P!IGѶ)u/V9>+- b54 ]y6y=r1v^mV*rt1PO. ͎a߂stTdŇvH˽G|%P%IH7CMHe;ytgDD5|;hfk-(L|QWˆ/bٛc"<mW'uՔ>&p AZٻ'^1?!Gb3޽ٵGÃ|~&ͺ8Gow{ @R>uۚ틻zk広|O[J?S#|wޑ\1&1N0h3UĻ.slv Cﺻo0Ѿ=a7gTx,|˨FB!F@ˌ$ zv!T.*wC vWnN}q sp{wd#Ԋ7o&&2s+>[skInd)6YW~h%+sRnCI 4XհڣΈ(@ƵkH5 ?aݡ [y%J}di%uh]4l]_t, =sBhϭ*2lPhވ6XGfsިȰ8c=HeW~/r- OO"D$N}mhԁˇoƽ! 6O*k$#߉hLM,!]xX\!{[strj2͎>xqz.8Y\LȾdŚc預>z s}7v&uLOQWT7|]2aY~%zW,Ű:jwgDBwI1z'LAs뗀xe po<ǧ<w Ù%UC+KÐDiesT)V{q㯮.@gÙ{hKAG\77ڻGxqƊ:`ApcjF2is8mi&"4oϻjOpDy׮lйhIŪ]Oz=mh, LA1aN6!͑~N*:bkZfWij$Xz?u!lf p'j94rZ\^Mز&U<+0%ayh#ߑ R[B ř0 +mVwڀXׇGEwQ팊M=tIh, R2h WHC=Ʉn۪Мzmx<MU%X%^UbnsQ4JPU1[R`Ag {3|[x浰t1:E9O̴QCKYz sP(źv8<9Ng8~ Iu+ #}, PL Q+PS0V*:,#ߎ}Q:úoe0u݋yw!xMH`:׈Н_/4 FU3(x$c )w,TZwҀR z0Sb׾v$viɔx>s$:T#zВi8Ym5އ-=[`WTi@PӗG{QGbx (OL#Z 2*؀Jmi#C׭su{q3J#o`nSྖpVY^q?UwWJLΛW,%6{iaޓ:W<;70ȯ]1p!;Y4 yҟ[~eDRU[$M69 N݆m~6?Nh_5֘z4'm眍*c31G}?A~h9kok-G3$$U1g3# 3MLFSs(ŅK2QJ>8믿O?:;;UϣPtPq\p8^A8?o}'?aU3=gC}KC|dPqrަ{/t#81AVˡZb'FLOiN \iY8}W{`Cㄽ['O.~yq31AӮڞ$⪟L,@{8;l3AY}vQl_n^pu_8J+7'FyjR7?ZvBڼlɍQTH ^ĤܽaQz5M3_|RU" f{l0tG~lC;"%ׁA m/./ԥjNAi$Na a{x͈0 πk./;8UUV'B 2̀.X.sg&ÝGtVpf Bٌ9fA_Zg|ZG,3x뺪df˘QWXÆI1cZLX=FA!SLźt!0P~Pku E'0Q־) +uPkij:\CA#@USǐx>hXseR2Z,G2@r/3(8*v8+K]lGPķèZ,dg?xc͎u+ɕ.ufYDBvӠ{8w0$YU]3_w;ItpX $\8s:!$30 wvvgw:+"adFVVuLL_"xtQvs};jSr!QZVη)u?_coN>B rf8 cɧ01uy5CQ>z~Q񸧅W"u;)FYUw)Id5QB IM&\M7Th6CX*Zsl<hLr,%HܓULhN /cZSdcp8z8 iU']po/G~~_݁͟{UwfOYh{&ågÀ[Bg<ۄxϙXZ kՂcG^e߫fٸU- f[rћac ٣fuBZV_%,E3dn Yy1ɱ!g<7%@@@#at3e zdǡ6LMDXy9eb^ !xui_VX-F$$mBڤ&%gFrc[M$a^ю+E>N7e u@ e#}FVڱ`XTuSx7~@R for@ЗuXsJ&Uj 6((S ӱ*I7$*f̥ H»cF9nF!2d"4YOIA:&idqwl}Cryҩ.2`V!YLFMbhKp# L?ܼG9R³^I@v@ jM hcXjP$%"uq}+_{/ XP#ܨ{3\%. SW{}׏xW\) DɎNU<,_}qM u-ZأҔiY+ap/VG9ZWuM`6Gv$sA Ĥ+($5@Ŕw·HJ FT/w Cr)8 JX=A1BhKCp :CH4*:c|1 13AH9s)kKs$_x/Uf NtϙTvg"|f k&hZ71%f"BꦌBUҺ\NjQyI)G?CNUӯ ƺ]rj^M8#@TRlaBӘˤB8sّiO'NIgggYoME'1bGbw35b4o Cam@mZFx9$\,OCwj*l6-(J F2xk'p'~01XU9QX,.w_ [ܝ d5l UC6CG"@55eى+N?awXBf,idE'x:?Hۚ> ܡt]eN蜤|7}|?\6J'T}X^XYp>' NT >tRfYbHHTY .F @ƒo|NX CC5,Bm} o$v<sZza@w8 xzi`Vi/3VLmh[ݩˡq݀Vm.lsאd R2(m^CA٠&U+؍Ƴꆮ`Ĉ_ڙj̟4 #,C)ݽdKzږHF֏mAYN#^WtA=hJ`ZH4)Z}Wmv}qu+UE<2t%`nm6U>].M+m,no 2F:ҫԺ봑Í9ȣd% MEvԫҠzW{|Ai 5U.Z:Wfd'uI+һ=K/M-B @V'硐 BK %)60CIz7Hݥ: ;r1bdD́b gH8##>U*ME.tԗY]] MBHyRv K\@@I`Y$)d 0˩q'x'Q\#[g,&˼h+cvRQ {ffNzƾ7ґ&tͮB. C44ހ5 )\U/ X ;\.t*=" \7וZé*_ ͟*V0i0gYO{~*^*c"ǓD甓~Ӯ3#^o< )BL#4l2ȀdFC&僷>ēwB&UZy;?o}ҊZ2l :BHBBM8L\§PgF&Ed3bF{DZ.ĥE=;?  P Mن6#^OXoӁq|̩޵ֿ~F.‚|Y%@?puNHGvh?Pg>_ȀעW1/]qwnYcɈ%t0$SDOht \c-^}ʺ_"GaC+u?_ыV( HB|o%ƒ 8RUDy`x`'IKl`nmZֵ_h]ş~( < A)1nI]µ8bhû_ xՆ _ND;uv,vrؗ秊C={ `YmMUtg|7wiLy@=m:At7uZ;?z;z"XvE \tþkF/M+|b- r+땪+[z[F]#32H$'ў\c`8i>Z6[`sN`nulB pYf%~[5 5   @{~HqEC3C>+\:DۼZW~7о>%B֟qCW\}2"65:=m 'w.Vݛ/w9^^> *g0cF[JĚ.sP94U_>CV#38Q\YDĞpwXf$19#v֘=elMբ:={*GӲ|z~e{iJіԾmK&&_?O^侨ꦩRف٬URDm櫳b7G@\f,2=!,p҆&wBmB`%u6<[0V <%9^v0J[Pe]crU 3&'?oWUUn)]tm-'G35j%Q)M $ EhfG#)_D9v_f,' bj @HlY<ֈXABH{wmv9,2ϩSQow{*T 9Ac#<'m3|AZ Hx!zv:g0ܿo(|ˢyQCr&r YS_Y{l4:LPcqϚ76EznL;p @@BqwzcgD (o'C|7!mjNQ>e[6o#FU޳ JmU4[ĘF|qZ-UϚ.yn$$7{Y~|0kl>B-og[ED%š`20 h >xYA?'5ȅj!)^ h ! (A!7X!"w_"ΙL8HHcI f1zQg9H:5a)NI[};u2;WEM7X@ p64o]H@;*F'2ZB5{xy*:iJKR<(*`"2p^{Q l!#] FI0 !"esiW(o-+?([x~n@_\<}J;|iH 8iõN&\ke*K[b<I}Bx74܆]Ia ɂ!>G?`9n5Tsʡ2RMGG<ܮ v Dń$@u;7|;nK7*g%o}~prW_w+刿P`< Hj.B k>CcHd_4U3l B??[]Y7˳׀zI2$$51_M6i8]?*qq\+/o6<LJ`Uf`Zc [aRvY9 3|X62i'Jc⾠_<*Ѷ53quqBd'ju=Ex{%)}axd5N0󅁛'|:/7:4}y$>C\~cG]3(֙^)~6(la/9{ ?]>:^9S0l7][%W&v"x$~Tuy= BVR؜ 'gfDNx {R?;m$a}C#)ejs*mOC=gJ_Jl. |4" nW>6v`f.G հ,}RKF_糏>P1 &xv [ M}7M*6ݨ8=D{BcZGtFr9H~ -9"[Xp\7GKvo įS~珞|1 `Hp %8 bkOB*8q{?\_9YGtg>Sg)8&vʶ6Sڝ_,i:HliGo2aR#;e߇pl gj.4&N3p!/ɀ߬sUm²Tepoa\M 8ë8yetQco" oowD/Qpa-Ѻ$BD7 #A4CMzBD?D`D "LRv#WƈN[ȂsL\,kBFMXyh]%c&ɵGH y~G|U«G % YtA#ខxፉf$ _PID_GUIDAN{5BEC14F2-0FAB-40FE-8B76-755C5019F540}H IHDR(lDgAMA pHYs';C IDATxK$IRfY~Mϴv4 H{o@bŝ+7 Cp $0jٝgDxddUuOdO6Jiifnn)%סv6̍#&LB̨Vd!,WD>:Ư79fC]CkP^eث.{SOIF eť%IBl@sd:Vwznmھ<[e*yI~Jh&&bLm.-놀;!hIFwu.&1b4wXc#}.+8)` 2T`U6˞A-aꮉ6IWFuĈ/[\I*drJ8%Mu!QLX/ްPdtv2@-zUY&fh_lmG#F=hO*&$ pUmTH0!9jqTf!VcATż:qc^^0T% Zɜe-ۦ#3)8*6)~Mj!"yjYTn+4{49.8cb0{vy˼;l'e~{Ye'$fJ%Iq&c9 UJ4挫,$n`Nz /N)IeGj<8?{PU݋nmvg>k?svv?xIUK=b@bpj8{V> +(E bS^>JdD\ &\$E1k/Hyc(ՌBrgϛnzĈ/Z!+A3E 8ߛe?WZ*Bޜ"a/[.e~r֐v'_jFlZjumq=6P>~)( !5 OqttDuӳ7 1hBwI dpJ)!<` eŊJ'^-$U0GCvlݳ#SmU:ĐQb :+$O2U֬y 8m㵁;ڜ1L{@o>];*!#s}/uMX.$gfˊ<(([y_7Ц9bqoqsMёG~4槵,AQ0=v#%YB,4|+B'ʿDhzǭ-MF~I%u kF_Z#cMy^9\~])d!dHpo(N}|{͑GnFWdK$.YJ<3ud='RU eE=nH.]|b`uVfo s/*I'CHe~p#FtFN6JF# ’*5nV k09gັJ%H&Cd/WHB($)., *uFч*s07xmh`rsudkxɝ㋅QRpÛ &i 3¤])_90{oO_G :GigX.'O'yz59=99;|yq`F=l:%buZ'x|'M&|0_=1BZ `?v7}Ժ?C^o .@M n.oC[]B|atZb`$NnV,q#"WJSØq(Av?TJŻH ۡmmږT0gw݀/L(wΊ&ݗ(KtըM+7vCK 'w"F!DP22zN$۩j)u'Te_4n{~tQGqy}G(wˊA?$ϱ1@M&a ~+ W!L$KB=d+1\ 365(l%t/~nzw[1WÚvAs#?!ݗ oJ7b.߯Az,/q G2 *u|흪Ku=)br5B6Swx;BWO_b/qg̺o0Td+Id~M ZHZ<2 տA8&մ+4643 H!ğ_;ڤyP]7UKLb6iZJDS#"JfݒqirӫzՋ%C3hڼuLFM9֛$lMN4ҫ%*|[YNOϛ; P!Q, Ցpbڥr5I5!A4]̞fŋȟ֫+ΥGszNwg=c fB W@l !;KO쐌dgGd{odTuNGy:Uu#2{:5xgsxmSS9TP>z!GA̎<D_N/Q<)@_rPz<>>'9cۀh^FaEP5L.ie8梄D;>kOdu1Hp꺛̚tHs͆_' k̚5M?k_;Ϯ?%3'&c릐\w.K6vAleA Qΰޥ Kou,H@X,g+"}$꾚8$+Sbz}^Yg3+gS ns>Pô.R哥_zmm'YWO||oųiaeu&|2U_+ĺ}5-Yv뮩XUeNoV /hp(Ԋ<0:܌c׿Od}(=_k J?.n|n⽕i_?K<9 Hh-"A8[UZ ^j?'U5@$تasl{ٵ2.;"6W(8/biꘟ|6wxz tU@2ZBBiR@GlGe*kty-Χߜ?=avv u3gw6"we(v[rI[c"L[WV%C$HȇHHIA*X b4w9:F:ɳW*vT̜^umM"&HK_YE }rNV{<8 %/*PVW w?íoځ^?E t`%B,8lTqmg -}OGrQtӄd[тP5\-Vu5,F{cƂAUS.O~FM”GB DDKH<BmkųZWa8^?:]`g<%* IQԕhJp@چ>b hMd jy6\I~ٹOOOggڴ%UciYO^DU[5^ցZr_EXOS"&mEm?7oSЩ Zv1Lp|M^Ϲa&0'm qJkT lO>,k1ƨbZd_VYIn횺I_/cԈk$Y TzMFjiL328)ȹn? ZŧdLa$2p9;ȧBlln4juUc )v~eյԏ?:;9_lz[io6Pn6K(H Y_RȤTT5 ?DE9WMQ#eo ҦCPՌ"PH,P伶uU- [ˋw�;aAeowFܨl$BC,'jp?o(ґW,iZC #cR`jSfGwEh]S7N @/D0zf o $ ?ӓ{|5i;k̄mטQ`Q0HjzAhV{: |wT>{ftU^M KRu(<zl ˧>;ǟO}%2Z"c2ܔ8z=+>TS#Pfptk,jSQ|c"s*/6@[cB0` p'}ÔHGAA}sX$%^z J)f.r%XyNLɢ DKl d3r$}+Mu'T:Aj2!WPcμb"pEh _Q|טQb %tXS*fZ>]V*P:lu==}$ lMpv]CJZla IװpUPfěL0S=HwvYWݤjq B`ԜYS䄌d5,9ՁC\feO3_󶺜)뽦'lDžԴ¦LB․F|rw 9RFeM׊Gzqj*L > "$#;O=i* 6jjdlD1p~=oI,I9WU#bME L{ڹ*!PgU;~$9T4wC`Mjc4|SN M6r%_#v߸etuzg 1"C]jLk4 c0L#egQ՜gc u)k~7L !H`"{/J0tBf(LT,d׆R*6`RFV}_[1!{%A}}urtfQ 0_iyVRP0#_yR)7Ϥ.E^~Yš.֏bu TJ6Rf4 J &hɯ"aYWb[vVO}~rzt݃8nZO!p2oH)ї({́n|C Qga!8o)Bţ ͦԈσjjzULT['M[@ڸ gK :Ё^HjD'oS8nGgF֋)^b56*,Wǜg8jJþ:IIO!~g?7ӯ.C/No*=Ёr,.Nxm>x> 2xB&ߏ8Hɧ{}w޽wc9 髢p 5C 1~:qyW030&V܆1SumNVУGJԼI\λ9Dr0@s 7:Я@p Z zIieE)ZN^/)nt_4G3z/~Mq6Σ-bq+n(@@B޷E%,/uV kGbv_A TIf$ҷl@G5"읻%YR[~<ݕpJ``@BBZaHКH g106HV+ 3CLNWWݪ{ztwUwt1By9U/8'"_!ckBD{Px]VB\ @STABZL9k/!A[eM$m܁yS^DYeX J(e_ `\K4?<[^W;I3;u6F.!UQz LvwإY/Grד80>ט֌7`RjWf}Ov,a˝(6ئV3j?3pYѿlt  boW[ uyrx8 9iSrהou铀`֧څu=a'〧{"!gw'V%ig:Aŵ۷yK;/b>Yt]|[Of+[<,#K6M5 ` fj@`6" G#SԤ9]ZТ&#kxU ZֱK L)YndPߌ>7ꕢg97-@ZYα)$48pXz}{ŵoТ.ugɓe*AEytÃgs}!RY+ZL6_hv⁸4&`JmbzM'M_]pgO>َ.rp m~N6g(g~1A3f\ QH{ Vi*=خ}h$oS<=w>#>'1M@)6dI_VU0lΞ^2r&V[3  $ʼn,X\4 5R4Ȑ0vƌ$ b*A^"Vy6JM[\rҘn]ZO %G[˖T L($|HJ4 Njw>$2I3^3J'VBjIFh(lP/^NmTt)Yڑl[.yDž!J/'1;1%/2Dbج=MD9Fh(ΘFXi|TFBmc9 _y:L1-/v$kujIc6#y[Ibʴ{Рg̘ӓty/|(G?iV,`1qTl֫@tv$hD e4m؞AZUAL(ES$$A]tNXiuٱ9˂CewWx@X T PLM GxeA̒<8޸U8w5u)bIfmۇ+>8va$'E"ii=I1ƘDgG%8R#]K 3$yKP"x޴Rf?/5hwnS%l kjS4<#o`[P+Roƌ7nNVْ"٨CwBM6,ݩυ3 LiX wmAF$lĒmTRmwd+e/!ҏv9a88cƛjwII%`tnXWh~vWPcQXL5_N6L$Ok ]i i/Gʀ°.g& !ۧ, u t m1/SjA#\"Ѩ{(mtemA''!gO޹@NEbFz; P(=oiku26ˇ@ þPTa4D$bP^M-cFlPC#B@:tfI9_ǟ~;>~M `UC*jF߄jK~Z(ntm,{E$Tw̥I{zVթ'z>4a o|C %@o0OC_u:ING' ph[\wufcփڒbބaAwm{02gG ! BoZm_6쩍_gq>zqT3f\f-6$$!Dß1Ɇj`92ÈǼKs ζ (y-/ij^qx0>wnwCHF3s`*犾s_%XgJ}(ix??}[ szͩ<^̈L=G1[N_]lh mQ'd^|,ՠ{9~ujv9,ieA+a_SO>zY*9}#FBS4QcrdW漚3Fjh4J }쳅twѕ.a4| ڋSV :޹g|v\3hM #-mLv:m2U8MvS`ڱ"F r~*U Rk-MYq9O䝘 H].IIh YvoBd.D(K2bzxP4`{X/K8_Zu1cj)yȓ 9>;uC+qt{ ISi7*=r$B\n{#IYxDddVuUkgg`Gbą>Hˍ#\\|E;'_#r]3;ʌȌڎT ̰ |.){{2:N h:4ФMD3:߽l|}RX,$>|t [!@_*g&dzzgTik~&{7sO$׏1Rveq_mFc::2yΓ]~);)E~r|_'Ckx%%,+v~~~PZmknr4_kMzP|䓏xt~߹՛ݩχe;PsB,M-_{kO?iJiPp3PW,WS)t-`Hva6bY9}Q9/{#>VY֓vxd.E@.OOÊpb-á[Q7'm;L'I ɭ\7s62lyS]FH%|tz㏤ EOp,kba[07Zi[kU-߹{|Ċed3.0wpPgc[2JԼٟ4&(jñNU&ؾ.y(9XOZr|I]yHxWu#[A?ؽ=Zx½S OHnujMǠpA ڴX'䀍ڵuKuC^̫(KJlYRΧ,+~%n>yC=Ǩdt7C+#̯MHQND=`Kh4oi//T =8 d$Wb~w+)x45e/Iݑf:Y֜ZTdX9+Cp.0?y!eQ~g+?y}gU_ 1q%EV*zfc9Ah 3D'c';ooC6"!ީHKpbK\[?^g9><=r'+۳Ͽo=/ih^GH\-5+-m]xm1k{?o?MKc_>:N^ܧٺt@L y*HC~Ћ1{z)9.9|p@~!SR=iYM \s NQEG9BZd=#?r/EDu%^ G4F!#EŪm幢r Bs BhAE2<6tio{ݒPc5Z{ZR;rS>kRBCVYւx(f8D5_ Zw-j誩g|\T!Gԩ@Ӌi9 qnc%#QהsLd_^wY{Ϊ7;/N5*KX:xC҇&dkN,WjV*Suofhg-vJfar);&@L1[ĢCѣGoYZj:#y|kbΘI8z3B bR"pb}ͨ6΢FxW|5ӓeuEaf]^Yx8C*ŅNAP%X]*)Iv|Rb M1?YRWDe63{Dq-,4Bs #=kR1=,M)̕2 T!fM &t8`p84)>? l8Fl]3n::ܚaR=&5(~b:<Gд,|je `H4Q*H0< *('7cMYtR!~]3 i%Ue><TS:H=6a;ַ4Wz5k!ӿj~[R#+Ed98xzKy|Zo Ԃ ytk:--_@S`/Rzt*ט% Z%k:%׀MF3v&OڙT{>W<[fE(:gF5oL!3sZad5¦=*}yA0Iuۿ@GK3?U.y^z]ɳm뚒`X)@; ɮ-0JH3И{*_tϵFM2L=K5!VtC %iC&qM8-f磀$[[mCb'v߇$ﻦxG4u:<ٱ+HHU[0gp0 Ef wKT?兵 o䣣Czn<)#}AtH+yT{QqW3Y`ly\^V@ƴkH=0<,hzaz)ngBAf4 6[ v(ϞO;\}dő&q)#^ x6CW%,t]h}Y7uYqJ ! _zT#@%-3LGāZXA^qZ{7~..l *e8K0绮sm󃈴n˲K|D@,}6A jh ) /702,M)F=gA/~z.yK>l{4!)T/顅PS*7i:)q,/ \. DVps psy ERt MF`U jg4ps}I+j/msӧOjv8F[U5ن5h,t,qG4jkچd d:;[WXiSȟ1x'|@־?^ۭ _O˃AJ顇vҍr)@ l;D,{|}Bq OH; |c`a$x-]t|kn7O O>o=[CQi ׸VLU&!3@&5zjkVR=Wz V` Z#5aD1gh5 .@_\~fyb+;}1EٱGCNM!aOl377ɡî ɏܸd;D=w`0_Rà,R&' IDATa Չ&ڝBXqAkE n"oY)v`G-ݎK=\G@0U z'X S_"7MoEh{1I%<ܾ)^RFjqo t]hGNPAQ [zEggߙ[G{Ĺ;4ht 8pޗ89n+T}/ZP!(e4J 򋯮3N4+t*bcyd 1K6qO0!0/o-yOl:O oJ1 xDNҀ^Nɶ &'+n BVPB$9T&DScO?E2g2ӖZ.6'Lh2[/wy74+%"l nAcƃF(f  ޺Kw gEՄ& h\<렁fx(O95+7%W24L|7P`+ňjEИ3Ҳ/Y+־mKA_X xN(=҉>\6@RMPڤͪ I:-fEw W+TT{[ش{&yƱH>DsjFb#$ÉtϮ_TswuƓ;o֊YITsZhF LEޫJg1!p?;;=:8( 8h2{([$XbCy!VR "q4Ur0`I\JCOu8v&Y)E( %#7O,WTF٠0cu.eYprX!Vsϟ8>MhVn&<0πwQNQEF=!6aMGo(A~t.D; Zl:1}tX3D@nnz 3N!q]8 J].-o<`vV/^?xW~_<߼Y?ԼA&4$~f-=w8Gy}~^ݺM/C T\t NZ~+ȥ6y&zerNt5\_fjʬߔ{F7͞bJףsiN263H,6ax ҧkDhR氱q(au˒h:ʊ@r% 'lzݙTV/jT̃QNE6$tT-I7Q&&rƙ *"kʔ}ijJnOəuKnkh 3v H.ZOpK᎐9jbƁ$g7lND31B6 нpKWe/J6p]}̓JCQRSΪinSf fPОRIQfHK܍z57}bb$m9+i!ك9᜺J~;PmyL7 z:XO (P ~4ܟxjj*I]@h)@,غ^j̫!t ŗU_u˶KsBպ]mu?_:U_.`E^몚]?9Rç>΃RN*VÃ[%4+V^(΁^uWm5/5+E C .A&u>Npہ [ݜ 弄pzWC8p(A9=}jV{ڑ{2n)g':mBng v!D \%APGBV޹Heewνzk{ @BaJ"p0a`h,ݙizg*2uƍWgugzS(VTĭ{yL&j~+kVM76ru0&D|G!rKd/$inVoZq{+Ҡ^s=>|F^KCbj pu kSla,b;?{bڽ hvWH jvYS%0bj./]֜Ib[?ʭF44'<{烗Gql"p2Wj ^4;MJZV&u+rֽWZ44L䟿wd,-oi1kg Hg_A&iu{Z錬.ы 6HA9{%Pݎ[T/_8wCoY|{9iWrĈX%s$* bo5n5 6YF'eᦍR(+Z. <kʚ(lga 9MR#In4moA4 \DBYmGIxb5kHtiA P1%$uCZVE]V<-rd CR!t+&P[PJ"[S4bīUyRv٧BjIFP@Y:! nPZ{]mV{O uҙml|J^ԥx[hS@ r[oJPe+7.MX+2F0x;d3jhA31L*sEl/̝l$ރ'@<o#Fln:>'>kfN` PAXBR@Nv5 PMp)4OS$s8d!x޽L`R9R:thR`&s.ۧ,u tqVPjA5(w#@eY .+LiJ#-\oy m8ٛgBRB-i i:x02a**Q:Vu\2؏ e9I>{7)LxYI$xC% kA گu0(o~տ_˰`ogjB70 xnzzFlM TmrCixpz *1У!ML {ׯ 8WWO9`F9["hqߧby{u$ @0he[Gq腋˰ Ʌ$ E,79bĻF]د%FҬD,֜ݲFY@-`p;{nXے=bĖab!~6?šȢ*lBngN@/`ۄ׶[: a=0F/,l}#Fl *'$X@vI)ٟHP֭H4Ȋ[259UIg֒˺pG9["ה3u@NobڮoXFJ T>9:e{PN'Gө>6 c(oO|9 'IE$gڢ]-ʹ[2x0I>zrt\oO2!1sv;q'Sf'/݁tA *Œ.jB9<9{l=??{>;GtDEjH1vmHUTϋӻկy~4cу䋧CgM+M%$ ԮldȪǏ?_yy?8;ezo[A a J=Ԅ?F gp !cY'jtO]+2/OH=B5nb'̟_<}w?S`*`[roSV>ǧwL?y<=ğ5/dvԸf!uԍ?3-s$;/"O>,  !$ 2{KBA2[ XH52=g꺏<7oWcWO=*uy2Keĉs"珢riJx/<~~ۯtzW ]Ğ)n|yu_ ^<~=^2y Kۜ1ƒG۬(f`Cs:~Np}:.ؓ ϩЬA(7 1^ ~|::o ^ ﾿} a5G톢JTK 'b#/Ot_%BkfA'ۦg"Bc@Ո$'y $72%h Yנ3踇"D(6-'coefVrV@&AކB}m,EvUx=(Lr*Ք?vOgfۄf~tDoG@ܹ)Ԉi4eQhgVsGّ,υ ^AP%76?&.񰢺x(2l+= l (x6\n0 }AH#(09rA<؊F!b M$'*dړlb}J$}uB:͏5޹<\t鮎C?џ13am(qF"fJZFtwIC-tua}sϴn<6I9c?, uz͌N%E8;\ٱ4D?H7n{E_X5=ZzNr*3. E6l!PB2;xHh r*cxvdR'LfxJ=ǖf[k[ٞ33:Ǵ) m?N4_\$oYa٥1K#Y?gxitKS YmN i}ٛ‚ܡ IDAT^ tCL =@(VP˜l#;їϑu^1=:v7~7YŶ_|?9 @@<#AbRa ?pQ5}|B,Y+ˣy\ݻƇ[y V*4ibZ4D MQi=EpꉭN޵\3=nV8a­CGc+dv35}1X&S G@Pw8kvvqޝo :&~Z v r~%BqQ{(ۚLYPU2ݓE׾Z,u(cRC ]pb$'yp-Ŏ*t\F G@Zw+DFh_F?S=,xDə(i$nzQ$V$byIN Mm'9ۖҠ* Hzw?8]չ3nwJKWH\WΩs._Ey IAMeKVg+EĹj8LNp-$ q#vڶ~ ejvMx[orl"\*ϫ`" %-wѯ$INV |$V]{yӣ(:XoWeE+އ mEfQb{g$oN<mf2@9Du &.2ʴy2H X흪RسZ.Z} ނ WMbO*8rs YRl7,{\~u:sj6]}LS7ҋhτFP(Qi3bSsM#>e'XXTɳͶ3,#4rA@^c~}Јh&ݴwE&.h|6ܱ*U&S9#U$ȤfCʋ;EHզpH6oc "eYlbiA0*h/b„WGA#P$Sݲ~(w]’pb}JlG./G0B(JC`.*337 a;7(WKeQs {>$?GRirJ,Q(BVQ6984wMiab g2fTSyXֿepYV<~mSD6y˶ l0a-#EEQ=C vM^Pm1"Sv„WcuI؟ZQO> .IOPn<{// = trJ!22 V'X9p%氲c^!Xv^g3σLO(^b2WyCIƎxdq׋MNDXyM҄-qOGINVe~ٓpL#;|FpۺY^}5z1O+ Fy@2o0MNP~# YYIjw_(G Q|W|ooy`ǽ#,ii@R/(hauz%ːֱT+W$@ (P~x>mƗ$,i-jQVP+yGЎ<兔>vn&wGbg2\Mr!DҢۮj m*J_`~5~h*/r_GĊ]`"#t F<S3`pW%m $oQ WCRT4-׊Ub]-y{5SF> -`%)xȝ=Rci{}sIJDH"ǝSB :t"gV:GGf A(ވwz#(53ħ[ 3))bݿG ~e2I.hhMd d̵?$`"Rx/*yN*XRhN6 [ 䌤װ<"SfNضm2$ q+&ăԡZy'JxJ/7䏦LOѲ΂IgZ;鹥7vg,_ cjD3 vås"]PPA5Q[(<ŋONڝਜep="U F@G&9ɗԩעx *Dq3sZL.'DXEA6ɱY$Ip\ӳӻGw6\0Fc5M)1V$:j |Q^AY1y 5dZξzglq:;cytIȊc||>x;Au/ >5b31m+%tR[bnOOU5{~ч,w"Eiэ ŕ*c_G~ou/O͊Cm~܃/Q7xWM\zZ$'9E0uݯ~[W_p^>oh^XآKNPl۬ժ^)+[WS7Lh&3Y)fec %/#YStoz2Ą&"䚔>?ILFIٮ}6WJIq4Q(1 nP¶huH&gҷ ͅvz~yR&qYUN5&5ISR _L-5 1jhd`NM-gu7% 3L3M&\0޻9s1&:i7 `Q[vY\H~Eئخ;تذc!=I[ iOˣP@L5[ﺓ;!;%כ^TKZe/o,ںv+pr?l\gj<.5Mx"KAZ41m˯M5|BCl\2XHX9 h W*Eb4!7j!*A9 +}Ff !Kʆ\:( f eQQ auh2'tck- G.jɊSYLTbJY'v*'91a"~j$oak'uCy^S9,szď~?ys?u̶$pݼ[X7*3 )[e^TҦE[ŝⅿ?{˃ӋًRJc||ҿ/?&;o" 67Wi3WW^<{O?}yo/ɝԁ(L:KIz|\)sFNxP`17XG< ^rØĤ{Eel!%]^rE;ٛ*xh|Gvq<ϚbR^dԇEK rtPGwX{zpƘq%%[iKi":WAbXl/?I6.ɤmY9pQe1I?ЕQ^mC3sn)ူ<,Ϛ(TÝUTڶF1kP$y|@;^RgˏV#*Džd@r[?E$T*C5P1@ b]ty4Zz4V;c6c61χd˥r78у(fl\=n1cpw!'jYLIӍ*n6@ NXKƓ%묻_ӣ:iL귛Z)bm)G- i\ѵFd~{b7P#G45F=vVtEʮD>}\ԍo|Yod}׽VJ}Voif\>Wo=;!\ݥ\'͡Qq/R Y09JL̑CμA@$RiZR[7q]7[q]{K2Os1{ ;nfF,?U;q[.Fd `8hOTĽ^ "7ZWulXX{5+&vѷ`uo bV[/W4\ ˹d˷7X㭷ae3gWY3O~?eW֥ z^~rV2>X$⩅Jj]5f㽋Y3OYJ[UUPĔF<֌5nx39b''?=0XKƐIz1+XfG=+(`PwjGs.4a'#ެ~OџN_cУQ/9Nf0ٴv|#)35 18^|pvyQ$QdBdN(jg  ^( 4Euj=z6xVcuVMkȅd׾ w -/j<( x^K4v.!!mL/pwiۣAfm\a?\Hj,3GLZj!P.*qۣ@,+)^$^Z:HSvxW9%zigP,.*k/?47C(kohL,  c|˸5{| 4|vV=89-O?|iv-IĿ7*ɦ4vϫtNyYxv6,-HE$1b++7}JGB^r!|vT'ōnMnċ&fdjrbӟ}])dR,n7BNut`~[hN[1*bPVn(~PF8Ow9x-ڢ0e%hˮ?!`4ޕ.J^*Chw6-ԠVZ!fSF34).c=>mzF<g|__pٗGyː)KԚ2}{]Ջ>hv_O~Plz>mZ6F\3Њx r\ v1b^nf>>L\@ٖi =z Z8I&u؊FJT0N);xFӍ[گ :6b;/ZH; 6lotoyp~=|;?䒁=z|#'?%d:ӯ~̚Vd8ǧ~&W$J~'ke?cP,Kaԧt9MAp\Ȓu{z~y_ĉE  q 0g8c$9[p@2\w^Λ7?2CfUW[ּήjEdDFFFl*A10b0H?mJLJiPLJb7䷿gDfh?>GKTw9|.l& l>?-!{SΌ&SԔ&4:u0,#?RBVKXʘWsgY2PJg:`.? M?M R!O koN)4bnTɧU5R"6%(ׄ@Z`W 7~8O R޶V{v*U³p[qGG:OG-TJϖ%ʆ"q_.G ǩjPh^^=9:OAGף<) a+Ba6t}uhZ? b嫒OY>c:霝~d43G|H(HjhPu׈@ݥ?dt>в\1=lzN5u[̓;>=彷?䍯Koot$Q˞rn~ĈO lL7&D *0~8\.R͇4jFmi$2w׿kO>[oes^: 7 *7ikm6\1AgM gN1颇*=i7If岙/G| ԃ~ u!a/ew M*_C=[a q>RU;O}|\G'HIT\oދ\|U^YA"dr KݗoH͚@ZĐ.𘲑e 1;97Qa4!F0X* 0=Hq_[uiwo1È56Ieh! + lK7i}B^EZr2qIxvCPNm!c'nAzjLUdoN7$|,RMx:w* 6E3zu9}D?ÿ޶NՈ Yr0 4Pۂ άJM7$=ґ>2IXo$eFn._m" &hqPd_1095711189 F@y|@y|1TableCompObj hObjInfo i0@0 Normal_HmH sH tH <A@< Default Paragraph Font  @Vl,b$ hKAE:F @|(  D   A"B S  ?)t@`@UnknownGz Times New Roman5Symbol3& z Arial"0hMjfMjf!02 Martin TompauwObjectPool@y|@y|WordDocumentXRSummaryInformation(DocumentSummaryInformation8k bjbj XR}}l uuu$ FuS"uuuu[uuuuuuuuuu &puuu 0uuuu jUmHnHuN N!"#K$L%n2F hKAEPNG  IHDRF-|gAMA pHYs /XM IDATxMƙ'YUô{ h/ ` ,I`? >{Gp^`=$߂I2$?r)3$F#PA%,򮔷?@SRU,L:T ? OOBi%Ґqn~=<;͟{Ug/ w3NOuў&mj+ҥ6"ID`;;MJ}ϺLZJDe̺3mcRځY!Ba;`1Rl*" $rfvXݸbC-"DߪFtGw8o9Ļ\Kgr@2B,#0.ӡ<!pl^gmpa&"Q}Pʫ)ͽg`zq˧JmkT?X^^+Ӣ:лo~m1 Z 3fw^9v2-d)XPwepԁkڮۏ W֞}`\LHqWWk{7.lSƘEOtZ# sVa2e?=v@uQWÜK?|-N,9֞uӱ0@O fĜJ>r*ٹOtqDkN+D#YɝU9*^TQ^xꐪ|ORֿhVxPk& &0*d+i5mI-,?$!@4 %"CEP&8n~pͅQF1rZf#hCf,`aˋW_ vH3 d,H/׮XdviH֬R ~,GtώGFƋ֦I*n>q"_T[q\5:+PsKNGT7k`JXźCj*-?Y Nlu/xrhj 1;.H42""4'#B+AGFZͳB9*m ӫrѫ](pgN%-JmLa֞r&q̄c/$;˳D$Se8;'oAп]'ahD'ZlJ>JCYճ맷U@DzËr(ΰ/s!9QWMhSg,<9)'kO{ O O6%"M l2tȺ{$ .&QN|;9=s|\hNO SLh8~n3;GDE0Q`w")=!Ά.qN[OMK䨭qLDN 7RjTkʼn|۽YGfbZ'"Cm21h:bz:JVE"DM1%@}"I0,353A,; $h$K71Of8`y<^}7o 3OՒYv O3Q,l%|TqRn/l?v-<;R>z6|t/q8!nY~ }Ґt1<%S .v3߽i>wTh_,/6o_??YxU}OuX{by_GyonNS\R$"wg};y.W'""J-K]N<[V~JpV:f2wxO" R Vr\y/L8!s_u{hICQZ#zܭ!"JUԞD,RPxu`'˳<˟]kt2d)?@]FGф4H:[xCx!O^l+j-6́z֨Ҷ]2de]dI =e^^2m{sdWb-K 2MRwCN"SmEc]6xb$W"M#/TMugd,; !ai~'[[ \2#;HtU))~JO)?A"|ѝ{ƭOݔIjܪȔ2 )l'"7ܻG[ω!LLD;*贾*4UdhhpGxGѯ(O2ߴϻܗū O}ڽu7J Tt1?J*{AV4 h8̩[ۚn}q7=FŌ*P'[mJ)Ϯnp{T*a?xw_~k#hHG1?A jOd_\AZS2κiDWPC)GD8 jХkcZHDUĎo}g ;S:θ~׽t;Z4a!ԇKTN~ PYbD4ro8zf,& 37PD`ͭgk:i]kWO% dRi\nx:{U L ]@b :5l] -?VJ;.,?o4<٦xF'}ye݁\G\iQpJU$JŒKRDU]sgmע.ac10QLc\Ƃ:SiVB~\zƝJI%/(R]('">*2IJa왽0`W39QӟO鲴QN tuJ)sɟGBjj杽 KDPT #eXnYlz&TPSwH,A%cǬwS_Ey-ز$cAI-*qԶghCpW.-.;~̶@SxeԻ<7%ұӃg._x=cxZ?%"l ~zҔ Oуw6ؽ*K^^>ǎ3 ֯cƂ&VHt.OfnK*hcS7DD ںRD>Nu}l9%ۼ; *G >O> 77cjh&q*w28p(u O5W#U>,%wp {5F9ÝhYxٖiexThWDsUQ{r&7E6PXP& G>y\UMz(X%Q#-g,8-5xx:o1.eXA;P\h欌+ zo{eP=={?Z^9 ODK5DƂ-_$fӢqIDKTz^i;D䰆vϰY ` Y vi`JwD+5qƂ $uF9%h|]CzkՏ_w?UXT>T:Y=~Ry|^ǹ#NXi㮮Va9;5m:PV\{zSW 3: ~KF:Qބrl^äò%YӠj{8WqMXaMRԄ$E$uӃʧT5JD @h%D^ޔ`6g/c\+K}fEDpē>~K ee#8BAӦ?f8.opwm{Uަ^>fa> mFPw/k&Y^UV-1<:$ :aÛ7gDPP$bQ#:_D ԩ O\@ %Ѱr]S5M WZ(Z,m& cY?)?NSJg# >O> 7#܊ݶF.Bbvhݒ9CxD`Ԕ=O )&"Gٸ|R͟l QW\y1Wyixgu0lMë&ʋ5.~XL^PK2۩_xC'` Ƈ2[φCU'oqqv.7lǷ&y[8%&8|/| :3!o+H+@~_ޭ; ۉk94.2{lrm6hH;K/߰fZBR0uX4kO<]_m}4ZƂ\qb#?Wx8t?=3w2uJ.WWHSy@Y{H~Ru*囿 "A^ruŏ8z)_q¼f#v<1&ZJ{flu4=Kt6 ۼ;^D!Ǧ5oD}ԶXW_)UXP{(sΥI ,?oUHGd:H ?:hnO_@{Wa`b}Pʫ)aV|];3Y~Bo~=X[2%"C62&Ya<,?cѥJ =P<(UFËZcBr#֍L X@D}4I*QgX{|^QS'bmǻ-4K39C)Y@yM`ޑXo2(QçK3Wu֞ά=qGwJp)T^ r0]魴> ' "%Z9jO{l'{ G+gtH:D]`mzTĶoUY赧tB6ehkdVH+*7eeFfrL"Ms&axR/EQ'f&!r阱tbwc@]~KQ @B4'%&鐱?R]zoGƛo`|e 3Y{JŞmoo4ŏaL^D4'_)/],qe6+U3ah)JQ3Q]Gxd,x(pJ- Xp\MD5ҨԌlIDaCUѸ3v4HV>i"$"GUԞzFsU4MDhNGྐÚQD+6 XpJ@)cA~`g4w2H}˞,y\>P vƂH]x{i@څ'e?RR BmzFZJ"bvW/]dI O|JD&m2!mܭi UD U  PZ!5=- 9qgC;k;5g˧|ڶpO+ݹK؉qhW[|yhOlZg/~A36*dw,SY#RqSihhwH+%xHIc)߸#Z_)3$׌P&.)f<Ѹ׌s9<q2֌#" v{wd>uj^h|5U%Ȕ1h_aKf'(wGyCɸs'")F'0D\)ל+g.28e' Fd, ߺx;L|oǦ\HzΫ71:D IDATΦEb5(~+S-4mF.:boL]hi$;wh":/eiZ]l-34?;Z @=/^MΣBލ\ru]9oп=_9v SZS>3V;`1lJD 7k˷ Jub&szg5nڎ,< :U[qj`xQ"1J3ax|s SƘ18;\q6>Jixwc9ˌ@WX@D#OugƂ='$Dv;9oƂ#3Ѹ㼻lvsLyROdՉ)瞒DD#Ͽ܉GDEFN[%R:ٺMuQr8I jXPX0$4c-J$DxNƂޡq3XLSxo>Ǟ# >i}4A!T ,I "+|۞Üv !"8R5^g pLyQ0*֛\y!p>g8㧈CM]CG;J4e"4TBt5ͫyv ?"r|# kOD䨊d@'sw3) 7E+T3PB6}X~dʋW_M:p]BCuWkO=M{؃UXp2ӺÚJcfXm H]Ӓaxy7'pY*w1#;MsƂa8c/~g, "*HkOxǴ~D1XNGM@^i"Vk5e"LzAΑ˒/WlҜ1Iv[R-^M%(@D= Z *M/Cqʝ=\,_D'HWXЕkNX~(w3xeuNƂBye^x.X7wi~>[>õ#VB6gge 2/SO nÑdÖo?i3;[JwSRAO ][€BcYQi>0 l< +A4/^<,Qg84sh|3WIbeCG{,kanz 2qu"O4gQVNӬC9 9C:UE2T0+da}sf, "j{_sGɮiӦ.=ke,f-|rQ5cD$-Ow*?;@^\e{GaYxcNuYa3і)1*Hw O=1 k^d Ǧ/REM&';0ij%MK+\.rZ> O>.m:x53-XzՌ{㒬ܩd}kQP`[m\5RƘq6Ե|MnG9-T. d̶QDͶ7f;Sh~ԭk+PzjaS5+6Fjwx?q;Lgi/t7$kvNNvn=Ҫ[q,Yב\¾۞0+|OD]?N/:[+_8翹n{C4n]Zk9L_S5m2"<;LWʚbcsazH0W}gyPf;]҉JJf!GOV~:'gS-vLJpTJ'CUbB||JUW Ͱ^6Y~'gWopoWF_|=&<8׸Wvcy?Ia2 CoBrÓ?f7JZj\։st'3ф@6zdʳ+wZb HnO\~60hKp& >O> 7@P|;<}C%Z1gj6sv=.e:{D)qRj]jbI,tLT}"Zi|@FYoY+m5NXE'sJ*2RTh%4욒Rѐ.$Z$cALj1I-'Z)ﲃ8}:ފuz#[ :vC`hZJ$De,˺:F]%n 2WZT B@AWUEZm'7fx"ZeQXpn9 j?d$3fqq%d)gO\ <r+aMS00_]hH3мFD)wj+wSk;Q:x'fSe,hR?`8&56ED]5gDvniU'"̚ >0AVa8!j U,"y"RHGҊ|f&yƏA\o~}Z&l`Aj\h:JDav^X>P1lQޭQ DtG3 PX"ڊ}?W#'"ڊ5ZUUZMhJD'.d`Pz:W$"P Gl"C]5hN/Yi5Y7E鈦4p[ˉh(PsU ,17@DgѠپymZ߮RUv]-$[QzS>QG j)uqB&wUNLi|&#B5iƂ˺N8RNw.ߗ*D5kNko. ADmd 8`.nqN2BkO DX IނHו]zޅXhxInuX18sҨ"W at<6Z{5l)цrZ>M"i֩=3*~-1Д&XJy5E3zn oM2e,YLP{a62LGH8G;61N-oJ9F0j|f%cp*̸ VTͨ&gX_3u+Q/~." ʭ1}uDL:yI7>3oߟ2{(fM(& ͪ-YgTfvhѸvw5 ʢ=UK5]tZKTr=#[PxER2dAᩅ""wVy H2$Vjz`+zj=p<#ph.c?˳彊UGcbx%S11ÅY~{+˺H:G:*^G\R Wog?^TN,7h)c|O)ɸw6X{qܬ,QY:%e՝m]'њ%Ԟhuk(c /&nͣMɮ+l3FEԑd͑yϜ4[u(YpDT'4Z}snp8f_AC0\sL?W OTY\^\nލF޾Tt+]zdYjOG?DT˯5ׁ׽KW8]+ZI)R{drUwVs~\愈Y*z 1Z0m/:C$ǯKxs{ k%(~mj{]i>~]Tdˬ>uf @@ܝ5jy@Ǐ=H9aȼ2Q hzѣP"8Rb;^pQ.QrJS!} @Trygn/^>sxn(Yxeakt6Իq(qwFh)#2ÓqP49F30BU7vFtOٸWeXi`(؋՞^u`o>{/ƪH=Tٸ#dtr"rɮq!y&HI#'ܶcՉbKYGD@;㛈 (?HWk>$|QJK eC2*DDSi7=Ň8ED4">O8bX9&8,S^pmFM"<6ވ)&"G;)"rK$ ^D45txþ|3f ֪졤)(֦HtFC4^jzʟ}ꣅ|u5MH5xѧ^x=g~pͅQF1ވwm1HR!W'Dݚ{})MNY$4,<˵8V[q|R{'d")>5MA,˸I.BHv$V~aAq7r9AIh@-֚KkOB*IPMzbhR{1i{槹D\>8NS+wJ 5g#.rm=ɅhLhh\ ORTԎkjC$ Yu"Yj[b186~2셤9qUԞzFS=Tޡ@>\kR4 H沤ㆹ +),e)Oj*Ԭ׭E'd? 40;2 OYƂd.7.֞ALxb㎨ ;iGqח2Ƹ\۳6]!ak'ᙹRxC|5NNPPqX4w,<1Arh,ܠ3?|=OtrppZK+P]+0w̞lm/`Z r'>{ {ZHN q{-@@>h|ÕGjGE}aˡY7;wxte< MO2L8zc`:(QB3K'2Zj)Gc*o@Ϯ&J:kevZQ`Dһ%X_ciS*e,g-ڜ~Sg4 ewinч- Sڸk,(tw .5EDu]/y;_xԨ%۸:wD..w\h>ܭ[w?n6[D3 իDYG 2nFhJT^yљN[I*`'ǫk[^YS5}Ӿ|J(khE|xX1I[it%E-=^x6Oœ^óDRtYWoۃh'(o~ 6K'ww8h|T<>: 'gWdS=YWZV=PZ,]JɞNES|'|[Dn;9,Ѣ2-Z}039=cJ[UѸ4Q$+ݡШ+ˋLD=X]2uo zf,O#f?ZK6 }-.v3ԂE3@/=cxja:wO>J3D:yY^x)sE+ѷsrio}9v&x(5lxZBڲ+gԛոVYaƲ75,?l\7Ue,`^EɟRbp6ΨY<~@Y2Y;\/+Zn|tP*IDAT-ݹK؉wyM?j@CN]GkCX;wmvHj=ޕk^dXF]r7.YX K:=ޕkw'r`2ՅO-KOd1hNƗi ixa L]@|@'=ths0 ؿfc<(l-]{Jai(o< _*Ar]wKSˍRzG),Cx;ȯ>rih&xkZh]uZ6DJ^ͽ?)SUT%d"76εRjK~Ӻ?bvItmhŘap +7Ϻ?vT|锿}O?}|#i18x ֊qD|ֶ/oT)囿pkC6kܭtljF1qܵ.}֊&â>hnU3qk?kCp#k;w<\hPɵUj?|đQCh-*smh|T!cAҤVɩIoP"wMjql6U^sRƂ䜻17ڟMݖ7@/^ (?>zp.WܟMs;ީD C"_l<wyS;txsF7Jv5^Aw`Ortmh:N<[6>bkC1_;<*ɳ~mRœuD ZkC!<@ˬJzU_7W pmhΎ*zEDP{*d))]oڧkC[Čx<*5Kn\Z&':[t27Z% dR)YMJqvBcy+Zc`Z3(e,#-vLJp5*gw_V4<~R"!,c\u*|tu vIJN.V*,_U^L/~=Ӛ)c6cIdz"Trj*_j!-_)eA|w>o|Њh$VmIENDB`Oh+'0l   ( 4 @LT\dss Martin Tompaoartart Normal.dotauwm2mMicrosoft Word 9.0@F#@F%p@ &p՜.+,0 hp  Donated by Intelt2  Title      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrsuvwxyz{|}~[?Q ty\cN)MSuuE .F-fvlϦlȡہ6еTU,#P?w$IE  Ţ:uXhf IDAT#YzO@@jG0A`@dSrr*bi鸓!=M>"^'Ns>;W9-ٝޜC۰ڶBHFCKhl<*9Ӽn ٵm9auϮi^cJZSH;ib y{ uKZ֣:ґ>1|lRЙȿuO鯵5˵t,)`aZ;5g3n{ns7}J9 +춙g#F<7Pirds QB1n新IYmeE yݼnWc5J7phwCbD(0g'ОzqBX_YYHo}Fxph BagpE)&du#F<"*x:(o{ LLk[8Pv59kk9diK S.htI?1מsf;7#F<D؀@ \Qt{vWS&|״k%BpE&yӮ.nE@=M0ٍH |D&#hĈ``:INGL "]4ĚVz ]2Lʫx8#6g'3u01Vr={ls}9=- \\Lw\dkJպTG˦'@ ݐbTF:(l0K%̭vIYkxh`+.GD(AXT!U0]AN m6RJP&Z/l xI\6e]Mj 80ZUHa3\4i*i%e@7IYLB8 LOe)X)."鿡e@vdUd%]!-:wslRĘ:+(\}0ڷvbB;e՛a aYiP (&ZLTАZf1=sJ^p^>?Ƀ 1>135F{P,4g0>?C[M0 B SQ싴P.~\b4pQE.SD-<93DݤR1<ޮλQ6^+N)igi}/ [WI Wiš~VcEi;|G3>;n;Qt%[+^gz?ussݑt])I( =:m}Aa7tipmϓvm϶Bh]$(rrxt߯!MmcH_pYOx4|kn(|{qY P M ZM ݿv,. &~2s윏ׇ]#CGQ#F8 OvR  ם+SQy2]uf69v'lvloO[jHG")z_]0 3n` :GbSIg8d֚tVܩU:nXfQ Xkg5lTR-}~ ė.Q6k^}| oF6hcYIa xjtR7hM]W777mX\܄ GzBr٬.+*кl\'k}׋[N6J[v?CY{@Dcu5(oߴPV i:AzI~='ֳb3b ]qpȜ\SbW 8*Pί@ul`u.à ln0k+4Poh>}G͟1;\q"CR瓓]+n@}kptW,"DrΟCQ[ (**˞n,xuLfmv]*(1;Wn/6E x>PLI Vc\z$KqGUut7a BH,_ [o /ٳbBbf{l) BpH,#!c:Dclp(}y\|biǔ%/""<◫jun3hJS;ABX]id~QFDmrS8CG%Oy+dvt+ nw''ݚz)mWfы^g&1 af[^Tyw !zMJy؀dj&l^Ld? mgDl[ƭ@=j `xTe5-C}a֫j,(!JD?~o֪t&` asூ*;O };XKߡU9me4a3A=< JCe_J`|Wگ_ HR49⯺yЧ @XlדiŦ`H.lj)10 OC '*ݱ@U0JSs0CzY_fieweN7Hh $ y1N, OsH Dl{ O{3ٟ>Fމ1M=}x6q ?!}pRC%ޣ-eTPm|ZZ'A ѲMʩ" PݰxQLI 5K%xkO,ZsԲ~+ti023VAʃF /nR?&Si}9kfίڶms!b*{un]Y;UMNMO?{m ʤ4rdfW&,o>ŢqI=kܢC&+EQ]VMLzpW^vSG]g D+4trB^NaO | )y 7юHqnȆESF()J`>eVN:%'VD_)/dP:{Cm*T .mm.?{T4oU 3PD xw}@IU BanppMJ ]-S`ӗȻ?#:sݦ+\'at1/օ5'3IbOѷO|p|[;̍?y <C>UJ߀x ]Mk^A}<] iO% Aw?%:uHwՇNۥvb} }ϖ4s/'U 6jsSFp2HO,,W׽/>k}ۋ'9a~RËg.WT k?F'd[F(UA(n[z”^ܬ}J14]uUFy`bS ,goh`鯨{d<1 7f0-[;jX `jqP&tJ頰*Vи_ bkP7Gt8k$lvtmr?%āzMic{v@cEފ0ٚs0U5~UMK v\Vu6Pov)qBA?]kr|oIly8E܈d|ҁC`O-t3`k3c{V7lΊOz#麪G#'PaM8#HL#"l{(0ޕuVc7*k}@G{2a?06~2ͤ7Gɟٷ%[z 3C < C+7?xܺ' @_;D\'GC& #, - 4ښAы޷%v;EB`RG/?T|<қԱ:zcfgK7l[z#$_nT60M`$ͭV$]Zh$H Ho}w' xPc؅_ks.d3ڍ+NWp'fJǧvL/X's0ID(4FxA`jS17"=,' SU8EE䰜^^t>)g+ӟ<}ۿx+O֛or- B_x*C\&(HW J>^_Ż>xW}rrf2Y =ڂ_KH߈?L@S.,^;@r)6]0h)W|/MA?G=?o>|WY/>ޗ<;(ەO pi5O%F<:2j(J)8=?ݵЎzg1۔ώ,;RM3p==M̾"al# !6#0<,Y"|f ,c\OxR-;e #,P$yG*NpjmC@9S{ה>N;BCeЍڕ@G#H@;|I.?;yx UuCb}A|vy8" qH ~߄C;PZj"[<AOtMx k<0޵URM'ы qwA7@s~|:}ŌAz¿}\4OݳO&Kք%wO?.<K~N|1 qJ֫/; ~ӁLڗ ֮w쳼!"1KmJv},ӌ'HA!qt2=='y ֓=GV|xJvK@gv =lݗc/dǒEزeeK{={(e7\ B9veH4Pmww.=$I#3134;.qqB∄p~|wBf{fvz둙4Uݙ۳=W:*"3iXY^og~vfg %$McYMN10h֫;~ͼַ4"v@ݿsWݻ(=k}dcNMFn{䚷DyR,mX  ~ Z.+JPφQ+ YOP^XOvoБ:]s nDB On ] U6PբoLR+·,]d[/%y5.ɺ}ٞvJ G< nzzv-i#}eV}SlڿA$[i$}/M)%\Q\Xpg!.}s/?:0$dm6ik};_+w/VRw0kOzS>{kǯ3i +șrI K8Ba {/3CdOeNr'ݲK7t~G.>זq{?,5pSex<~$ttPWd`Z4Rg{|7gr4߫x :<)uN:'H~c~Z,U|ݟj\ vIe޿QY#E}Ճw?.`Jgm5utSDyvcFz)[+I~|||{?ϚQ1J^#}ThEb,Ϲsե-zG31PJFZfx ,=M$? I觥-eU/WW_.n9-Z1c QĂhZ׶z9=pN/ Mɏz5F|á׏:^l-{!+ ۜ@ 5{"opZ;, d! jN+7unFA#nڹtanCU+9B֫7vr$9 ^\ yfh-SXa SJhVD;-;$7b8?*'h֭o_ ip+`񸜝ݵO`\,.w,a6﫦;A`Ab> gG\qL͓`(giyc5yc59RH&Pqz)z(Έ*F#Ri$&sgd5`bv6&-Χy >MO a2 ,ěBQOTZU$Nק/Dz-uwyoD7uq t<Y 1R-4h3GB:4/݋?eŭũc6Mkx1InE/x_<5m"s/Hj$W As&6{v{FcMt x[o~[?үtpg{/Zk3ĶAGgՏަ#R@"GF]W&/^[F7޾ $v÷"u^o-ȦJz_WG:R?a@e ene) qF4 *ZbH֭=5 6|>5u"az@zl{ԀuC tCrZibĆnEo-!9= 'L$)h)m U~vjk?b'(WTO:;iӋgf,,(!*h%]R)K)!q^L\MrZ)xR=U@R%uusFфNUJ"~1:GVYbZͥu^v@cDEnJ<BU0G;ȲS򲩜;UHm|ֽ j8mGx}zV,]> 'ߟMYIu;`6VɌ,4;TM`hc x$j=9  X)uV1iS]BC MⲦBh &5'ՖX*@sdG'DS%ASvzg褎>3<1CDWbQj{%X Т,&Karj$ɕBB-ZӨ{^]=ӶbI$yGxUm-8 4iw4'8Y{:Ȧ"q"1}iCJpxO#,/'SH !HJTHaįA@n|LJ>O?gsB 2$I̞AQDn@VZǏ{iWGd|IVu$ X47bGshE"(>PK λDdg ]YBSh EQGYj8yp,,Mgs;HtTR>h 1Ҳ֏O{8aį O2V+2^r@Y>K eO>{;*,2q.2|B'{mәڒiSHPXGMsį P.H3&h`ɣG?hqS&Zڒ숰.]#Mn)PBm6ITHՠVZvBFzq#$4kW4:x#U'L#~[qA/6iaER4 nc3qe{|6âiUULж{w?Ͽ;=~Ǐ1օCRkgNz#}۩Webԡ,OwOgπ~//̲H:[m6)a  v0@lY,발kz}_!a'sX@ ,!!!`}}0;@ W1~ת[#qw*Q;%#EІ͸}S{NC0GM7c絕G߰{ (@iՒf+^o ]Ko#g'rt! 8>DGIA5@"x7̦G-Htq,ZXN fejA6:*ml-~}$O0mE/ ^C{#ז1Ww5`C @/B?=998m·ݾ7Q$#5mzorB6ΊW9Y^0 Ng2#D d$ HŊx ruR/&~O>=?w'>x׿uzz_߹pJZ`IDž#daul&__~|}s{Y.~9P(X&l;s#F|P!IGѶ)u/V9>+- b54 ]y6y=r1v^mV*rt1PO. ͎a߂stTdŇvH˽G|%P%IH7CMHe;ytgDD5|;hfk-(L|QWˆ/bٛc"<mW'uՔ>&p AZٻ'^1?!Gb3޽ٵGÃ|~&ͺ8Gow{ @R>uۚ틻zk広|O[J?S#|wޑ\1&1N0h3UĻ.slv Cﺻo0Ѿ=a7gTx,|˨FB!F@ˌ$ zv!T.*wC vWnN}q sp{wd#Ԋ7o&&2s+>[skInd)6YW~h%+sRnCI 4XհڣΈ(@ƵkH5 ?aݡ [y%J}di%uh]4l]_t, =sBhϭ*2lPhވ6XGfsިȰ8c=HeW~/r- OO"D$N}mhԁˇoƽ! 6O*k$#߉hLM,!]xX\!{[strj2͎>xqz.8Y\LȾdŚc預>z s}7v&uLOQWT7|]2aY~%zW,Ű:jwgDBwI1z'LAs뗀xe po<ǧ<w Ù%UC+KÐDiesT)V{q㯮.@gÙ{hKAG\77ڻGxqƊ:`ApcjF2is8mi&"4oϻjOpDy׮lйhIŪ]Oz=mh, LA1aN6!͑~N*:bkZfWij$Xz?u!lf p'j94rZ\^Mز&U<+0%ayh#ߑ R[B ř0 +mVwڀXׇGEwQ팊M=tIh, R2h WHC=Ʉn۪Мzmx<MU%X%^UbnsQ4JPU1[R`Ag {3|[x浰t1:E9O̴QCKYz sP(źv8<9Ng8~ Iu+ #}, PL Q+PS0V*:,#ߎ}Q:úoe0u݋yw!xMH`:׈Н_/4 FU3(x$c )w,TZwҀR z0Sb׾v$viɔx>s$:T#zВi8Ym5އ-=[`WTi@PӗG{QGbx (OL#Z 2*؀Jmi#C׭su{q3J#o`nSྖpVY^q?UwWJLΛW,%6{iaޓ:W<;70ȯ]1p!;Y4 yҟ[~eDRU[$M69 N݆m~6?Nh_5֘z4'm眍*c31G}?A~h9kok-G3$$U1g3# 3MLFSs(ŅK2QJ>8믿O?:;;UϣPtPq\p8^A8?o}'?aU3=gC}KC|dPqrަ{/t#81AVˡZb'FLOiN \iY8}W{`Cㄽ['O.~yq31AӮڞ$⪟L,@{8;l3AY}vQl_n^pu_8J+7'FyjR7?ZvBڼlɍQTH ^ĤܽaQz5M3_|RU" f{l0tG~lC;"%ׁA m/./ԥjNAi$Na a{x͈0 πk./;8UUV'B 2̀.X.sg&ÝGtVpf Bٌ9fA_Zg|ZG,3x뺪df˘QWXÆI1cZLX=FA!SLźt!0P~Pku E'0Q־) +uPkij:\CA#@USǐx>hXseR2Z,G2@r/3(8*v8+K]lGPķèZ,dg?xc͎u+ɕ.ufYDBvӠ{8w0$YU]3_w;ItpX $\8s:!$30 wvvgw:+"adFVVuLL_"xtQvs};jSr!QZVη)u?_coN>B rf8 cɧ01uy5CQ>z~Q񸧅W"u;)FYUw)Id5QB IM&\M7Th6CX*Zsl<hLr,%HܓULhN /cZSdcp8z8 iU']po/G~~_݁͟{UwfOYh{&ågÀ[Bg<ۄxϙXZ kՂcG^e߫fٸU- f[rћac ٣fuBZV_%,E3dn Yy1ɱ!g<7%@@@#at3e zdǡ6LMDXy9eb^ !xui_VX-F$$mBڤ&%gFrc[M$a^ю+E>N7e u@ e#}FVڱ`XTuSx7~@R for@ЗuXsJ&Uj 6((S ӱ*I7$*f̥ H»cF9nF!2d"4YOIA:&idqwl}Cryҩ.2`V!YLFMbhKp# L?ܼG9R³^I@v@ jM hcXjP$%"uq}+_{/ XP#ܨ{3\%. SW{}׏xW\) DɎNU<,_}qM u-ZأҔiY+ap/VG9ZWuM`6Gv$sA Ĥ+($5@Ŕw·HJ FT/w Cr)8 JX=A1BhKCp :CH4*:c|1 13AH9s)kKs$_x/Uf NtϙTvg"|f k&hZ71%f"BꦌBUҺ\NjQyI)G?CNUӯ ƺ]rj^M8#@TRlaBӘˤB8sّiO'NIgggYoME'1bGbw35b4o Cam@mZFx9$\,OCwj*l6-(J F2xk'p'~01XU9QX,.w_ [ܝ d5l UC6CG"@55eى+N?awXBf,idE'x:?Hۚ> ܡt]eN蜤|7}|?\6J'T}X^XYp>' NT >tRfYbHHTY .F @ƒo|NX CC5,Bm} o$v<sZza@w8 xzi`Vi/3VLmh[ݩˡq݀Vm.lsאd R2(m^CA٠&U+؍Ƴꆮ`Ĉ_ڙj̟4 #,C)ݽdKzږHF֏mAYN#^WtA=hJ`ZH4)Z}Wmv}qu+UE<2t%`nm6U>].M+m,no 2F:ҫԺ봑Í9ȣd% MEvԫҠzW{|Ai 5U.Z:Wfd'uI+һ=K/M-B @V'硐 BK %)60CIz7Hݥ: ;r1bdD́b gH8##>U*ME.tԗY]] MBHyRv K\@@I`Y$)d 0˩q'x'Q\#[g,&˼h+cvRQ {ffNzƾ7ґ&tͮB. C44ހ5 )\U/ X ;\.t*=" \7וZé*_ ͟*V0i0gYO{~*^*c"ǓD甓~Ӯ3#^o< )BL#4l2ȀdFC&僷>ēwB&UZy;?o}ҊZ2l :BHBBM8L\§PgF&Ed3bF{DZ.ĥE=;?  P Mن6#^OXoӁq|̩޵ֿ~F.‚|Y%@?puNHGvh?Pg>_ȀעW1/]qwnYcɈ%t0$SDOht \c-^}ʺ_"GaC+u?_ыV( HB|o%ƒ 8RUDy`x`'IKl`nmZֵ_h]ş~( < A)1nI]µ8bhû_ xՆ _ND;uv,vrؗ秊C={ `YmMUtg|7wiLy@=m:At7uZ;?z;z"XvE \tþkF/M+|b- r+땪+[z[F]#32H$'ў\c`8i>Z6[`sN`nulB pYf%~[5 5   @{~HqEC3C>+\:DۼZW~7о>%B֟qCW\}2"65:=m 'w.Vݛ/w9^^> *g0cF[JĚ.sP94U_>CV#38Q\YDĞpwXf$19#v֘=elMբ:={*GӲ|z~e{iJіԾmK&&_?O^侨ꦩRف٬URDm櫳b7G@\f,2=!,p҆&wBmB`%u6<[0V <%9^v0J[Pe]crU 3&'?oWUUn)]tm-'G35j%Q)M $ EhfG#)_D9v_f,' bj @HlY<ֈXABH{wmv9,2ϩSQow{*T 9Ac#<'m3|AZ Hx!zv:g0ܿo(|ˢyQCr&r YS_Y{l4:LPcqϚ76EznL;p @@BqwzcgD (o'C|7!mjNQ>e[6o#FU޳ JmU4[ĘF|qZ-UϚ.yn$$7{Y~|0kl>B-og[ED%š`20 h >xYA?'5ȅj!)^ h ! (A!7X!"w_"ΙL8HHcI f1zQg9H:5a)NI[};u2;WEM7X@ p64o]H@;*F'2ZB5{xy*:iJKR<(*`"2p^{Q l!#] FI0 !"esiW(o-+?([x~n@_\<}J;|iH 8iõN&\ke*K[b<I}Bx74܆]Ia ɂ!>G?`9n5Tsʡ2RMGG<ܮ v Dń$@u;7|;nK7*g%o}~prW_w+刿P`< Hj.B k>CcHd_4U3l B??[]Y7˳׀zI2$$51_M6i8]?*qq\+/o6<LJ`Uf`Zc [aRvY9 3|X62i'Jc⾠_<*Ѷ53quqBd'ju=Ex{%)}axd5N0󅁛'|:/7:4}y$>C\~cG]3(֙^)~6(la/9{ ?]>:^9S0l7][%W&v"x$~Tuy= BVR؜ 'gfDNx {R?;m$a}C#)ejs*mOC=gJ_Jl. |4" nW>6v`f.G հ,}RKF_糏>P1 &xv [ M}7M*6ݨ8=D{BcZGtFr9H~ -9"[Xp\7GKvo įS~珞|1 `Hp %8 bkOB*8q{?\_9YGtg>Sg)8&vʶ6Sڝ_,i:HliGo2aR#;e߇pl gj.4&N3p!/ɀ߬sUm²Tepoa\M 8ë8yetQco" oowD/Qpa-Ѻ$BD7 #A4CMzBD?D`D "LRv#WƈN[ȂsL\,kBFMXyh]%c&ɵGH y~G|U«G % YtA#ខxፉf$gyݭ~ꪷxfbw~''Oo9!$O_?=^~~cw uƓ['='|r7{o|YSOգ?a:b#=HG &. 0څo}oo^qџHO؏O~U/z[{sqbY )| u-'O'We>~?s_?>1@dE׎miiqFLLt]a !c!օXx`#ךhOcLE]5tTGŗN0*&g̿Yr{ cirfO^i3/>D%] /]!V%G3ɐ7ԗbm@{ڏ־Տ;B~<{ڷϝ!o󻵰tw0x2ԧWc]r|\\l,X TO'˰Q^Qg?߹g0m4~z(o?#C|O9I (% w)l2,iWT,HI~Apj k׋~?F?z5yRkŷ׌sxVӤo:!~/h$_ ڏ[~GYߨӨ U~G<|sTX фC~h?9\ ^ L{>0|`}Ӟ4#O S6rԸc|ʭeﴬ_NRZ ?I~z(nl?scP-t?|SlO'͆]*U-SE>y>HSQî܌YN~3׷ݼS+_~Q#vAQm~Jl֟\/R|L'|{/}gol?#o\>0|E; |/>dگws+<>_[| {e[B|(nn;'C2qzwԤ4U~=s;f>INI~ 59:ĵ;cG9-Ov-I}rtnQ>nȯ7z.#?)Bq#2Bz*צ`$J5Aϊ)a~Q]9TD'O ?槮+e ?tQ*짰Z@Tǭ Գ*':=*PNs}KT}Zi#OJ@#*FlzhUt\Y)<=9$|PO?%/hEKoŖO}U'q~`4{Tpؓ˹?i &"u~$OSmSG3_Ȩ*g Vh@ >~ܷ9U G8{l,Dh;9.>XXUs6Y^?rɓ(IEL'.8uk.>V;? w.'8K*|-ߐ8`;߉, "-xΕuI\p#e< y/NM_8rTjc~#3 *>y6Gp>SA :͛6*Ʈȥr*A5oڴR o||jzANj|`fy?Ow/ 5ξ)wDj&M?šʕz~ZU ?AP~ 2?<ʩduUkbjߑe'}'O~sHO D=#> oʾ95axi~jB 3Z'?5 jwxu';gwzh]MD %Ԁ? ~jAփ0i O"Mvu~K거AVr. Q߼csE=Jɩ_hH{Ԕ4^SWsȴE^Cs75kB|"YGפ2_vܰi ^ӊoj7'RzYkwC?5̀?A(''OP 큟 s`F)'j}sokW `J# ᱚ݊z_} e|Ԅ4dw'uq׏8u"yM{`=R즵י ƛ'lOP:6] ki'kWϢJu僸 .qc令2wB~ ?';kگ\લ}jZriCU{A ^/(O!k~ 7e-0*PP6k6"<L?WaMW~ ~D5 (Ok1~=ѫ'kD| lG?As@?aإfwZkKj'$רhX/V퓥úw-RhV}CඪᬛgF?c7}K3W]~cM y8Q vc]qs9FԴD]ۓ1t?~O_n!CC^uG :l?e@kIaqLOycoyD_2>^? ǟ~O߹ i^;˪CLӵv~z }{/UB~O'w=6s26|kzZS^9{~*IbTt۲͔%,-W,(3' T0VpJZvJs'z8~SdRfa,I뫄֣XӾWVe: _l|hO_zF^i[+yתKa;\?΅;Nqz3d|hOz#l?`,z}5+ƨ:f5[B|/o~>}k;4O1 wd3 ?)9ݧ?O{kwUSƔWw-2k( x}?]sۉ~b ~O&wݵ]|O1 ~OPJ7%~ =tVWd׎r&9S:ԞvجPe?9sܫt;;4gu[ ѷT!*ɰ\N90 Ps?W~rr'D @~WԌu\ Ubj5P_z^Y9ɩOIsx{ |ʕ} _P ;w)CL:wɏ!o~2 駭ʐ7')?'7 V۩WYx2 6gI#g^ھ[ gjiI_|.oO?i\ZIJ՛]*ՠ" @ν2$Z`v%6w50( @O;__@+M+}J w{jd'~bm'웽㴌+B,M,%oy@O s2zRG@hVRJ~Ǩ8@֜]WCGȻ=Ե5oE垴Sf~JJ򓅟pOW+zY`?'nwsN9] 2Vr3<xV8@~UwNKĻFS^ȑZ$?VsHG8'g}K' ѯ_p'n}VCONN~X?/;\%G@~ ^yѻI%~mTwYK;V3z|4돏_:qidں1(l9g 7ҩ7{VG Pq? 46,HAoOŭgsG=p6~4g@#T@ 2] K*EO9ӡ>1Z~3-,aϲ r?) YH<׷!o#~,+JQ*62OUS^]Ns}K;쑝}i߈08ZlLm.jV.Ы/py;;8}cyC~U UQ885}Q% c܍-J__ɐ7ԗ-J\O?WNrOJNsײ pnv-JWzSvefH~a&OPk?CtmO3Q۪8!{'w7sמ)ŶW$8TO)H'i*B1{6g;WQj*EY ?mZ g~Kb8.}~fiOOZZ#ʊ;jkB'C0Ore{.' c~ڇ '.} ৰQф0)+Zj0)?4,Ge`' wn;1_g|`ov.H;QH\<~77| :Bq~w{9ٟ?;W y"w7jٻu;hx15|mUZ#=@-{'H~䝎qৱO .kol<r` Ó`,bjt'0OBV88{ Tf VT۵;*:@rQ]H4׷#֮JbMk?X[B9FPqu|}:u &gJ6QU Ͼscǟ ?~S,zPk?%/hE&ss2U հv.u ԰৉XS}94ۼ+0?g| ?ߵ5u7OEO~O?o0~hJϒ|ݚ"`:B|.* b,hNZW1ZQ?''*S0:P5?Q Bf 6P@uNٜ\>0T(̠B?Lsp 4Cǩ PY?X Bf|,n= yc +9~;k dIv 4ߖ!o@Ɵr/ay=2 yc>4f㧐 ~z(o?#CM?u҆0{/%:CWP?~)OkqU2ٟsM^wY3C{>1+zr=xKWsp';'y ]uYPMT՘\:Ofς`WC]#?}E? p?O58On3u]Q?TUW>Oݺ̬oip`>ƭX'A*jj7F)7oym?\㚏:ase#*z$w ?qoicn{wNfFW1X m1Tѫ_pqD&kZ?494( 19sqjZuoK+UO~LZ#~Տ;Zw" Mh7+*7rE#~?gJ~?[ij˛2ǧ}cKv4df;rSwt}U$k̜[qgscfs> y~j(r}?q'PS}5SɲO VS 51~2O:vQ?z~Q;AP-a#y^5䜗ꫴGaZ&lB{XM*'kK곻 Z#G3\5fܱ^>0O9'5+חu߷?>0wnU,`yϼzi}^ũgx?  *7:_>Squׂw@q."NTS6l?,aRJ3>nB$9(OwxB`u' w ?P\з^7fQ)"Cκ=0566Fh?m*'M&YV@羬(}} 3P b֊_@羬/}YJSɓ/?¢WW4yR 9 O/}bt;ʡ@?+~?O'O?~2a~ i@3V?߅z<*w(oA?CRd?)6\ ؃ "RQY-W&0-soi';1J}Ԋ ?aAQ_fߕ}h|LS`1q%K?{c\7;J&gbߧmߏE#y8~0r)]5ͺ JLBèm o}U Zqֽ~{VO?QX0* yTts;U;jx2Ծ S7✕$~{~yϼ ˵1qO{A&?@n~Ҧm00S&J,h^)T}|gM'vLiy#zboQL*~ ,j\,AۿOPOLʄi7jZ)"D1Ts2jR?TOIg]@Fyiyw}{D~Eգ=~:-QKd픵h_n{-@~< ZIVZ /}^N_*~|`fy] Ww/_/‘ wn >ħSw~;tVY@O+A =>"d7l'mUB~~r/UThՎP?Ae ~ wy]ѵrȯ1>^+7/@O?L]7Y5t?x jc\9oC`1⧼;{ +ϹK?mD]'y#Gp['Cy8~I? Nt~Z-%9y$koy3i'OxXghFo3ռcr,4ݦf*w ?muʸ.JU(3o~fQ'Oָ]df37Kg~xYVz`r+<@@~f'oAՌ:vJ$i8>v3Kv032'l494K]OЄ'_^NeoN~益 uShrU9>x蓆 TY5 ͧ3odO>~\Tc޸|`ov.q3\VMHyZh&Oʧ-|xWטb_)lV@q~}~A+[B|(~'ܵ<~ߥ+'k\-# ݟS>o@-g^P< ?@H/9\ ?~r_;c, ӺәZ) O@c#SN~*v3~JvRZg Il@vD=qFԹkQo.&~0OV׳ݢf%ZWUk6Mw fvO{Ͼȼ?zvG/Hڻ O?߹8eč?Ib{).yv`d)<=ѽ3{y '7Q~H姑2 _+~Oi;^S>0~|ޯ_ .,Ie/Oֱe'{ʴ')uX)u}K b~Ruzwʐ7B,}i_{wyq3}vӰ~A+~G/(}[u{_jC >~^ڇ֭X7ѧOyg~&&HϮO641O@ S>~lL'9Nr?%S$>,g\_Rݵ\6^d}~)}/}go8-o/y=sz}sqj‘P*+?V֟'8`=cɐ7ԗ'~z)B}$RSܲ,,{L~xqa{^xP kzW\5}?]ODV ~OWPR~?'`Y3iOO)3iQS_ѡu]AfgOp.AmO 򓿿V*O nSEg}S>h&~5և/M,i. oS~p/X:Zڵbք'2) Ɵ)Qu(|yi8>=x /ld}Sh'; p<.\'pió]ԮvKvN p d'5޴n>_ rp~fg.@~*` H2ca4O,t/6}1rSݦř|n_?@N~reR Z+'pۥQN#OTڮUOZ)秵< ?~O#~4b.,qৱ ~pf`Kt?7v3CE?jZ0's}K{.Bџnd} ?~&wo'uড়yK OO3gލKq~|@N](%c)]ԸJ-K`cVI`sϾs77.,;_t|ǴWmv=DI~-!>?mo/u֜>QU0ZΎGɝ̥pOJNhQ~8X?umtۯZPmו ?hv {aQ\]z?S ?@9~ t`L,Z#P:B|!vs{/WH?E[ƲLd$̦UP|P} 2#R3)_YXisΪD;k2ZN'OSӗ&O0fy?~^8+CHl_ϼW1g64Oj{UU d|$n= y#nz#>?+I6O@~s-~AN#o[C{ӾQ+ٯ_pbz~W]%;bV/RLӞ޷Wm蘱O~5h_"}~}cIK~G{7wYϬDא= kTyl3?eUJҞE_Y9ܘՉ+FOL7ҞE'#~*8+n>M'3i=zyVy~bb,P4awTܞn ??Y]B?Yj$aA-~*lH Ӗ,{I$48gsy? cU, OPG?w#vtSq#TOm_.p F V^QP,8XmnK'=kӬ=v-\=wN~9z؄7z f/HZ S-vr|D8~R)l;'#uu99?E~/̽ _SP?4O-qEw%pLIrPM? ׮~rƟz~h?7xv+.y%@-짿5Oh?YSJJ9LӺ}ʾk&wqPn~!03b kSp2P1?u}*?c:J~]^Qȳ6김Ӱ~Oi0Ua+C@R=#^]ڿBm;*  ~|EtdWY?4OnmTG??g;_iUOS*{G%I{ᡱC7]r!yg9ơ~Ux/'EiS4e 8/TO:2Y_r:)X?Aow~[,Sh~b{Uv 9~tz$_ f-}yG}ۧo&oRoBON&Of\ }#}y5/~{'giKNQo|15/9sm _c BҚ0OMw ?~M̟O }޸F_wƲ:8~j^'4k?X+dF 1y15&qw ^rzOVW+~yjYȑ~H/{^Yk 'X„gHhzvo=lokӉfzT| Њ]M{޴淶z'~A"ZG]{޹^;3+˶]&gbӞEO<ơJv p$AŧUQ}T W.k{^RO:ػiQ_.i_xOSsO?)W~)rV~R󻀥=[+O݇JY?yڤ?  S 5>~Y?9ZW\7YUIΪ~\K>xBM3ۿ}Q0Ag^sҺYuvG۳?XڷۼUg<->:cz S@wg:? 7O_b=o}U_\Oz~Jn0@;O~ O;O&@mg}˃ A-hU,!8'GQ!> !m,L4N`q2VioN{o?_^dbw'&&"|zvꉉׇ~gBHQFonDd, }Y  c ^A:..\..\..\thesis\cggagwwa.jpgRm4{<(>o=C_PLׄeuuoM>P֐iږm'Ə}f CCt S;x,-j ˈ,Ѩ 4yv"#R50*3WJiQ_ޥ[ ~S_&GG&G]YWfX(?ϳ>?h84hh84h?ϳWwٟ`Q_k}Ѵ~_?^k}Ѵ~_?^?Ͽ??fxq_هV+~x?ϰ(5?cN//Z?5?cN//Z?<8+?rji?o^_"~a9k|a{yi?ؚ-ϕm%Mo6GK־?~5Z_ǟ?ƿڻNG P_b"Gi?\>˩?t3o>+ĮS%S.Z.qV|E14xxL-IUZ>{JWh6"W{yY)'CxYO-s{IGi 4`(5?cN//Z?5?cN//Z/G,?+3ܷG7y}&GG&GGC#g}eb[>_?_?!}A3Ï>?_-Qf}E| Fq|hz Fq|hz>řE~fX(?ϳ>?h84hh84h?ϳWwٟ`Q_k}Ѵ~_?^k}Ѵ~_?^?Ͽ??fxq_هV+~x?ϰ(5?cN//Z?5?cN//Z?<8+?r<|ӭ{}2o /ūh7Ԟ!9|_Jkp^iXx@[-'OCdo?7hI ??k0<91ՠSL^M-)xln"]z`hJJyi:9uZmי3GƏHWW ;G3GƏHWW ;]CG3?՟o Y_ +fvfvS!A?Kp8Voί`W#[|^/`W~ ּMj&5 SA?;;J?]F?>4Bl"`O;o|Y큤|R\G?S *o ]xCI5OúontW^|ܧ}ȸ{\5ˀE,1 ⇆__j54*p YV+g5C 'ά<2⨩SV4U*' +fvfv TpGx/2W?!__'@qW⟈?Cg[֕oYAſj|U_KN/W:8oo?gGcm4KJ>qq3V)e%N9T3s;GK*j<7j4ŠG$++?_?QC?i ?_'?E$_ ;k%mw(yV'}[N}^LMaWar\Eog콝 \gN\WW#P7&m$\C8,#niSo_ +fvfvU29#?Q-Y:?+E| ` `d?s8#C>A<}aoMJE?GثNcQ^CJ̺' yV7`D^3^ e^%18N"iPRukWVqJ(JJ!JQNP8S`*T(C89T)JM()=mE| ` `?CG3?՟8_e+7Wg(>4Bl"`O?>4Bl"`O?Lg/?+Q-Y:?+E| ` `d?s8#[uV~WG$++G$++TpGx/2W?!__'@{4w  _w-}?F3Ϸ[jQ 'bccN[+|n]ZXO=Ztjf0>R{ZVЧNSeJ64ԝ]| K7'V>e.X(c(,~_5?|i_NzĿ>>cZ^gڶmj:oCrPzp,2I_w?h/U}f0'qa1҂x>| FC_r؈%fTadײI]S8EQ~=XEIfe5A`Q_ý`O11Tý`O11U?WL_駲?;2V +w F;4|*w F;4|*xqE_fzOCe Ϗ_;> G;> G<8_?3=첏̿ՅǯююWYGf_jz}_Hoi_`ý`O11Tý`O11UxqoeCJhfy\"_sں8O_{88\^Q<3)hXWuY{Oiw%}_ov> 1~~пo_ ޭDŽoQ^4ҴcN-9zKjxHý`O11Up#|9f8ǵ~'iyFC9\49[0xxsXY,$bp8biS<)Zj9>.r˰ԨV ,T?Z~48MJK)]E|?cFQ?cFWP7??;2V +w F;4|*w F;4|*xqE_fzOCe Ϗ_~?{?oпi?;> G;> _mxq׈)?VCj;D,w~ԱV긎Oe/G'NofX̱ٙ0Z^xXcj{?i=~nI[ююU+gQAٗ`Q_ý`O11Tý`O11T}CÏ*C3z( X_|zOO(޿'_?޿'_>|o!=eve/>=W_w?h/U_w?h/UP7?;2V +w F;4|*w F;4|*xqE_fzOCe Ϗ_;> G;> G<8_?3=첏̿Յǯю< ' ^kZO<=ehw^}yq]]O+Y<;,5hf/ha:uaU^5UG,*s:^&U `S)F  w<~*NJ\AӊiseQE!?h߇5? x5mFG!_,ӿ4,#ş~2\xzY,+2;VҮ| _+h(83.^:0KO+T`g[:T;.u2Lt%Ξc >,Y3n/%~_n/%~_o!g-tG_uZ _}4Q _}4WQ?XK?_j{\s/:-~?/BW(/BW+ (Jq, =Q@9pq|+z q|+z }Ï%8CZ(_sK_Ḿ Е`o?Ḿ Е`o>o!g-Oke\/93+ l _o ?"~>MS Y\KWo6n/%~_8)lSK -2u9n7Ï*[cmS KAe|Q1}.Pprla`0gAJtjf8RIJf5#N*h3Sn/%~_n/%~_টc؇g+H~㯆i֩;L>.x :Amb#GNsc=zԡVgqd[T8NɩF0iArD2p%ҍZҌJj-9a˰ {xlO7*:fRRO;m{n/%~_n/%~_w)2~ד _k7lWG7lW_`QG8S`d?,r̿? _+h _+h()2~G_uZ _}4Q _}4WQ?XK?_j{\s/:-~?/BW(/BW+ (Jq, =Q@9pq|+z q|+z }Ï%8CZ(_sK_Ḿ Е`o?Ḿ Е`o>o!g-Oke\/9_J?^CE_J?^CE}E_N7Ł?2în/%~_#y {Ɠ??ew~V׺}YOx[P}NKXk7:ݔzkMi:՗Q\gW[ÜYJXlN72| Fէ_C؊is'N? &~YgRXQcUru3=Zqʜr2U`^QE|x?ӺNgm[Y{yo׺wZe',|pӯxt}roi7LԵo7h84k +0`W~V>>[szW~V_?_?(kG/ m'Əm'Ə}_o? mm|s { ]/Z6xO_~$ּ]_/g- N(buJ>ie\KPԼ=c(U: 1TiW30U7)%jRk>kW9V>eS8n*ffVђBrӒ}! Fq|hz Fq|hzK_~?>0!U/6_D<WxW>y'.A˼(|C_&O9ďk8CJ#s|G>53xjt27Ⱈu?yV:ڝ:~?.֞]Yf?(TQrY N/1 :)UMo6GK־?~[^K1/W?[szW~V_?_?(kG/ m'Əm'Ə}E^CFς?ߕaOߕ?h84hh84k (Z6|#}{ B|&GG&G_`QGאѳ/wc_77wo5?cN//Z?5?cN//Z?ּ0?+^П-=+| Fq|hz Fq|hzQ?l# G]Xo ][Mo6GK֏Mo6GK־!g_?Lװ'no_k}Ѵ~_?^ 5///U|icz egUGvEp? >=7{bմ BBO\i/5/mۈ,G$++G$++("}@Ï<>?q_->Q>_v| ` `Q>gB_vڸ(/ϻ>?hI ??hhI ??k (O/ϻ\Wϔݟ4|h~E~? Nc)oj[=,EGO!ꖿ Y |9?x[ 4K\mBc?K/8n0ܦ ig_߇tpOx7 C#iÆ!VUqhЫOT\=:OCR,)] Z~ 20Jhcq485[ V5P^5r춤kVSG V0VFsR*u15/>4Bl"`O?>4Bl"`O? g8S\Wϔݟ4|h~E~4|h~E~@Ͽ?YqЧ݇+}eg?Ϗ>4Bl"`O?>4Bl"`O? g8SW>3g?!__'@?!__'@}E3V~)aYoafvfvpG+??Ϭ G0~}3GƏHWW ;G3GƏHWW ;_`QGD 8# y~}j[||>G$++G$++("}@Ï<>?q_->Q>_v| ` `Q>gB_vڸ(/ϻ>?hI ??hhI ??k (O/ϻ\Wϔݟ4|h~E~|3x?zO/BW+fa 9.?aZTu|@&Zm4W^b\vU>c*3o\!,5s5T̸dx Rqq^g<[.ƥjXl|a!e8;0c*ٍ7[,'N x,` RnZkюю _+h _+hߗ.2~_? zc#Gbzc#Gb/BW(/BW(ߗ?.2~_? zc#Gbzc#Gb/BW(/BW(ߗ?.2~_? zc#Gbzc#Gb/BW(/BW(ߗ?.2~_? zc#Gbzc#Gb/BW(/BW(ߗ?.2~_? zc#Gb>~_o%_¨i࿇ahbo!h_?5y?n| _+h`Q>0heh?|G??y|4w Wsmglin8#_63mhg7\a}}_~ٜؿ>OsoW='7O`+ +(xu;o~ϣP~ #,5?c㆝}çG][xO,$ey&G_Y0Pp:8*1qmZ2<&; ;ibpj%M3]ԍL ҩefV¤}E| Fq|hz Fq|hz_C#g}V+~x?ϰ(5?cN//Z?5?cN//Z?<8+?r?_~K#'$/?$o,쿈??! < oi&AEG u7!_C Vu /I_fO'm'Ə~wI,/~| <1^޾c|6+6]-I}JnlmL~e9M>{`252p̰JSlT!?\ 7/:+aS +Mo6GK֏Mo6GKֿ?ϳ>c+?r_?_?!}A3Ï>?_-Qf}E| Fq|hz Fq|hz>řE~fX(?ϳ>?h84hh84h?ϳWwٟ`Q_k}Ѵ~_?^k}Ѵ~_?^?Ͽ??fxq_هV+~x?ϰ(5?cN//Z?5?cN//Z?<8+?r<|ӭ{}2o /ūh7Ԟ!9|_Jkp^iXx@[-'OCdo?7hI ??k0<91ՠSL^M-)xln"]z`hJJyi:9uZmי~W>G'>0[ mkO᭿; # ;k%m+fv  ''?OoM?a)1!8wI_pkx?\EyOɸ,4x/c}o}^V7^ƅNi[#?~`*}k+`r9[HÖW9F] +fvfv TpGx/2W?!__'@?!__'@CG3?՟Ϩq_՟?hI ??hhI ??hU29#}G Cf3GƏHWW ;G3GƏHWW ;G gs8_e+7Wg(iOe_{_S?Whh?byej~uoC(b}Ώw4|h~E~ۊ ;l W/kb_<,eaRpnl51Wf8 R f]'ӥJgےS0Ne唥/WWFwV׻R_`Q_4|h~E~4|h~E~d?s8#4Bl"`O?>4Bl"`O?Lg/?+Q-Y:?+E| ` `d?s8#[uV~WG$++G$++TpGx/2W?!__'@?!__'@CG3?՟Ϩq_՟?hI ??k>|4ÿKh_?kE~ 7wn}SI<};8sp8*ج7q^r'yӧ/cS7.^1/JEKtʶ:r3,"QѧƤ((R\>zc.^ir^EWAEx?cbOt%Pԭt;=gŞյmQյ[}2S.gO7zc#Gb08><ˈ <J5. {VA+5R &Jﺝ<./ {a/jK4)7JююxqE_fzOM=QAٗ`Q_ý`O11Tý`O11T}CÏ*C3z( X_|zOO(޿'_?޿'_>|o!=eve/>=W_w?h/U|3W 1~^!f~]/>xOFxK+N4Qßzש$d+Aɳ=q2;}J G;> ^_<8_?3=>( X_|zOO A;'F?zc#Gbzc#GbTĎ^_l1^xI`~? > xr^7kywf,ϙa>8r/J_ao(޿'_?޿'_KW=QAٗ`Q_ý`O11Tý`O11T}CÏ*C3z( X_|zOO(޿'_?޿'_>|o!=eve/>=WςL__/5x#^édZ^?_w?h/Uz nU{ǸLuWS2qÕVMnT)?erQrDyyTdSU)P' 9eX[VM|$uq4[vZڟ`Q_ý`O11Tý`O11UCÏ*C3zc첏̿ՅǯююWYGf_jz}E|?cFQ?cFQ?WL_{,/5a=>?zc#Gbzc#GbU+g=QAٗ`Q_ý`O11Tý`O11T}CÏ*C3z( X_|zOO(޿'_/~|3 W_%>x/$?؟h??ƯMGOۮ| TUeA8>\ǃViJJ|n'Յ:20*O.9:mJܐBsUemfF|QRrQE?h߇5? x5mFG!_,ӿ4,#ş~2\xzY,+2;VҮ| _+h(83.^:0KO+T`g[:T;.u2Lt%Ξc >,Y3n/%~_n/%~_nڇ1 :Ghozi ~_fx%/Y`Ybjދm_` {[O7/ӕY^O&va+yz_J?^CE_J?^CE}E|8S`d?,'?2în/%~_n/%~_qDYKS _k7lW_{?P&7/|56.#CI5O6^"Ees/k^Wx(= ͱyUScx[xF<Ï2#q5 a$rʒ:s*XJج67 Nۗv]^"_`,\΄v+,I(ePj0ܜcYSR9 _}4Q _}4W5_ſ[  C 4*OH??E Kɸ7?G'g ˔>듣):*ҝݟ8L>_ϰc0|,mB'qg/}Z=oa _}4Q _}4WWÏ%8CZ{\s/:-~?/BW(/BW+ (Jq, =Q@9pq|+z q|+z }Ï%8CZ(_sK_Ḿ Е`o?Ḿ Е`o>o!g-Oke\/93+ l _o ?"~>MS Y\KWo6n/%~_8)lSK -2u9n7Ï*[cmS KAe|Q1}.Pprla`0gAJtjf8RIJf5#N*h3Sn/%~_n/%~__)2~׋ _k7lWG7lW_`QG8S`d?,r̿? _+h _+h()2~G_uZ _}4Q _}4WQ?XK?_j{\s/:-~?/BW(/BW+ (Jq, =Q@9pq|+z  >8/7"' Zh'//*?t#Ep8 O()2Wf8i<:tzUվ74ۛBOZA[jZk}Ѵ~_?^#Jzyj0Pc8/$_Ѭ6 NJiݾx=8F5gVLNoƕ4N _?kπ߷W ?3wSLOM/{?5?~n: g8. 7<__ >7q8Z KgR0{0b)^[KK' SS2)/z.ͫ4_?_?(kG?װ'no_k}Ѵ~_?^k}Ѵ~_?^y>`W~V>>[szW~V_?_?(kG/ m'Ə| Kɟ(¯E' ܽ"_aE{y'w_8#cs5>f~?9=a*+5Jla=򼶟ְp~[S)rrG߇,ּW>?h84hh84k +Z6|#/ m'Əm'Ə|_L_ s:Ma>&ּSS>#i:>i7czmǙku`W~V>>[szW~V_?_?(kG/ m'Əm'Ə}E^CFς?ߕaOߕ?h84hh84k (Z6|#}{ B|&GG&G_`QGאѳ/wc_77wo5?cN//Z?5?cN//Z?ּ0?+^П-=+| Fq|hz Fq|hzQ?l# G]Xo ][Mo6GKֽFXÿe/ ㏍>3ly?_J>ݨ.c(Lj2v  -׫3,ƵqnJK4˥ P{RQU*ԲR jjf2 J-2N/K\EWGG>~mxO|jRxO)]{mAa[l>K]QU߆?,y~ jQSp&/>?&/>?袺# ? ~}k3ws߆?߆??# ? ~},'?P>O~b8~O~b8~(/oV~+`?&/>?袏ABgB_v 3ws߆?߆??# ? ~},'?P>߀e{7r|qaQ~þkĺ?OC7Q{?{?QGD~ _/ϻt]dG? oL_| oL_|E ß|>gYwO?' 1 ?G' 1 ?EG7+?Y'Oe?Os|6q'@6q'@Q?_9Wfx?ut>Q{?{?QGD~ _/ϻt]dG? oL_| oL_|E ß|>gYwO?' 1 ?^(6c/;+Q sڟIc؟nQ\99 JT+>zwp^ON}ed yҊ|U/mIԡWZ\uzJpF3廣zҧ%ZXk$Wڟw)Ɗ(Ģߧ3mDd")  c ^A:..\..\..\thesis\aawtttty.jpgRIluZRUT %lFluZRUT JFIFCC" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?a2#1eG#c*0lXW/^?σ?>C큫R\7w[>;ovQ_Wkٷ XLn%NLC)jYvMK0Q"tmTxR<3˰1X5*<&]V5OTz`CHo9e?Gsʭ ;__}K ;__}K<8_?3=~( X_|zOK??Gs?a2#1[w,+藣w,+藣WYGf_jzY??dFQ є~?ÿu?a_Dÿu?a_DP7?;2V0!FQ$72`CHo9eV/C %/C %U+g=QAٗa2#1eG#c*0lXW/G0lXW/G<8_?3=첏̿Յǯ є~?(?U~ `¿oz?~ `¿oz>|o!=eve/>=`CHo9e?Gsʭ ;__}K ;__}K?WL_{,/5a=,eG#c(??dFWx3}Ə`jgW?a ;__}Kqo7_ٹp?5 GC2ʾ$Ǜ~6!?IoG1dxϨ{*\_J~zp95og2bO,->|ACGKGh >8jWZ=Int{GIү4ɮ^k3OH~?a2#1?? |?b6i~ڞ?,uK-CM,o~zm[iڶaoljzs1ÿu?a_D{|I^>]x6ԝ8h)Vc FGfT9n'7e`aKBGux︕~\"~U*u,?V~ 5##;IW߰T?a2#1öeOk-/C^?kOA1H/M>a ;__}K׉ƹKfo`pFA8׼5 *ֳOxox>j؇y'FGQ[kP ә;V~~П/ݢ_m|!w6v OxgƸ#üԦS-ԉ(Ӹg_Z^!p~ ¦]qqqX>Z|._*uvEUTLpqk)ftBi护eԴP'E_xW GK֏xW GK־C)2~׃ _k<+% kG<+% k_`QG8S`d?,r̿?~~()2~G_uZ ?cI ?cIQ?XK?_j{\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Z>o!g-Oke\/9&?VxH wMk/~=?~&BG}4-O?;MJh5?HxW GK־8x:gX \{%Nxoxxxg̫8>biҥzP,+̱2}9SeXfv2Өܲ{UY9u+ ?cI ?cIW}Ï%8CZ{\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Z>o!g-Oke\/9?ė/ͭ?ė/ͭ|^W??o 4)O3Ə|!+׈"wHmпϳi_m<pVM\AYxU>QgMG,\g\L'K)۞4;M8ܶ]˱xܧ2Ͱ}c9T䥕ԝ+M5^4E_?ė/ͭ?ė/ͭO] '|)c ;)^1y#7#O_E?_emq6W<ĜAle_`1yneKbk{,Fק)e3>Jyp J6oxW GK֏xW GK־OqDYK^ke\/9b?k'c~'O3ׇhOֿZMѴ=F|]sƭXieK`W~V>>[szW~V_G#_G#⯰(kG/ ?'G?'G}E^CFς?ߕaOߕ?H??8H??8 (Z6|#}{ B|4ƏG G4ƏG _`QGאѳ/wc_77wo4=l-`O*?4=l-`O*?ּ0?+^П-=+| /`kqQ /`kqWQ?l# G]Xo ][i_ _i_ _!g_?Lװ'no_KhzZTKhzZUy>`W~V>>[szW~V_G#_G#⯰(kG/ v~ʟ/=:m/43&*~?S~^/?E;{vZ'OQ\_fؤZ߼?'G}E~ƞ>c=!ú_<;[ZYxK)>12NMV-f(5ojQcNi~Od =~9|r_&o _axk_ڟ|n $Ѵ}úĻHO>wOss7XϏo>x[: ̫q`8pYt8y}0ʳ*sgVl% 8*LEmZ٦2NWB5sVaRrN](BSƜy?4=l-`O*?4=l-`O*kG/ ?'G}E93Ըg$a6#+s.OA_Sޯ={lEzU= r?ֱXrY>K˛_? _? (s"}@Ï<>Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aT}?aU@Ͽ?YqЧ݇+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoaBo9wGL*Bo9wGL*pG+??Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aT}?aUAɂ|! G0xS[gD|!_ոNhk?qZobdy.s2ڟo?Wʖ)dk_ ~[2YRx>[ct䦣qUSm5." yr`g'rRR:}BZ4nY_? _? ("}@Ï<>Ϭ G0~}!_;_`QExyc߫}wP_3|;?,/߷_{zӛG<&ܷ >ܫsr^\?/C %/C %~|_$mh~|_$mk/_\Ͱ_\b=.O|=?O8c)Ҷ2oKSQ+Y6?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z:;oo~_?#?.2~_? /C %hv^4? i:w}3CukZM,fxİ[&:^777R ?cICg>x^%eh!5(5-\6{;Vm:L.n, X%F0lO\?}gٯk?{eoi?ymrS|}|7-˯-_n~?#_Ο\S ]S?i'#ybH??8?¯{ J /< W(»t_Nj4oQ_K NcQßzצjJo][UĹG9p]UW0'Cl.68jXn0C]p+,6c 8aBs G/( e\b!ўU͝o# zIe̛e*j uUZt +i_ _i_ _ !}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*?4=l-`O*?<8+?r_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*?4=l-`O*?<8+?rwOss7~W߱Oy_fw߯x%zb߉ڧ.0|}k_x{?xPciq缸C_? |U|:ϼP#S+ʫa(R˨S:k J(3N+:9ni˱>0Uujai„21BPh(QI$}E|WG/hQWG/hW_V~W>[uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg( cAߍ0? cAߍ0?Lg/?+Q-Y:?+E|WG/hQWG/hQd?s8#[uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg( cAߍ0? cAߍ0?Lg/?+Q-Y:?+E|WG/hQWG/hQd?s8#- 㟊>`h>oxƚ77T[VhGX}::N}]?g(y-|`k z77K4[/sVֿh;Xӿt}F:cZygX]?>) U~}og2wsoOc{mʧ콯'77-k;(~ `¿oz?~ `¿ozU+ge Ϗ_0lXW/G0lXW/G<8_?3=첏̿Յǯw,+藣w,+藣WYGf_jz}E| ;__}K ;__}K?WL_{,/5a=>?/C %/C %U+g=QAٗ`Q_Ņ~Ņ~}CÏ*C3z( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=+/B;_~{KE:7_o0~G/7) wH//M_@ޗúom5}W&|['Ņ~ۋ P1XL:lN/LC6ifYMW0+V"YSeU1xYU ,02X%umZi-gSnnn7 ХE֔˲:Tѫ!y2:8x6&>"(?UbIα:Xh6Tط'}qK^f>W~|_$mh~|_$mk +Jq, G_uZ ?cI ?cIQ?XK?_j{\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK_ۧ]~+>'hOxk^>kZuk'Cm7:jڍ͵X[\^Akkl~߷OGؓ9?lo_)={ľ E= <#:j^.tcIml5=2{[")#_֊3s/jZhC!_ O% sbu^Ippo97a9?<0x|N/2Z9.;XRB*ԫ*Xg[RhЩu>SO ^w^*8xacF*Q9&?ė/ͭ?ė/ͭ}E~i?XK?_k\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Z>o!g-Oke\/9?ė/ͭ?ė/ͭ}_T/(/;s>9£ W G"» xo}ged[ڟkч?f >|8 %?&p_l:_)L^.%k:>ܻͱl/,F7UQRmGWʩ҅Җ*F+?ė/ͭ?ė/ͭ}E|8S`d?,?2îxW GK֏xW GK־qDYKS _k<+% kG<+% k_`QG8S`d?,r̿?~~()2~G_uZ=! mjٿ^/oOX4~81<'/L?ghv>(G%:>ܼԡLUoP~|_$mk +r_rZj^~7uxΦcq>ZU^_tM8zZQߌ2f*-9Vaۭ e:O&dfU)%9)_<+% kG<+% k_`Q_!?XK?_kr̿?~(<uYY {/[\3ÿUV=c?o͈\UnoiU,O5yy= kKs^6|KhzZTKhzZUNO~<x_%_O"ևoOmccQ]C?4o< !N&̸W7üNaK){/fTLO˖2*sڪsBlS1Uuh.yQʛ֏+eNNѨis%t>?H??8H??8 +ּ0?+q}{ B|4ƏG G4ƏG _`QGאѳ/wc_77wo4=l-`O*?4=l-`O*?ּ0?+^П-=+| /`kqWe__*`eX'AwGп?*F?1 g _Xv/A5%gs%ca"J? kbڟ_M>i^qM^!/p_˽b9sZ*Šψ>6XoS9|$xŖj|GևKhzZTKhzZUאѳ/wo_77wo4=l-`O*?4=l-`O*?ּ0?+^П-=+| /`kqQ /`kqWQ?l# G]Xo ][i_ _i_ _!g_?Lװ'no_KhzZU/KcCf/- |xNJ|1/(|L]mE}CwVvw^mɬIJm* $"+kk袊?`W~V>>[szW~V_G#_G#⯰(kG/ ?'G?'G}E^CFς?ߕaOߕ?H??8H??8 (Z6|#}{ B|4ƏG _`QExyk.8w{okJ\˓?gWs?T7ojǛ^nOga9y,\mV&ܖ|ϒy+g/ا|W~47!C%oYH/ՠ}_ؚ~[y?n/'Bo9wGL*:o394{cq>m*վQxzh^4ob~ZN^z)rB0K݄#Ϗ cAߍ0? cAߍ0 g8Sq_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aU1Oy y ]7o^- kkeuE $__bb?e~-I?bLxkS_\)^#ZOZK[C=0}BS ['?yB/+].Xyo!_;G!_;_`Q^_D 8# y~}ُ+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoaBo9wGL*Bo9wGL*pG+??Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aT}?aU@Ͽ?YqЧ݇+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoaxGܶ;~Пk}cLĺ7c~m+$tĺ;6f?i7uj y4۟+sxЯ MqU^ q\[AtQϞ*o/G aU0 h8pR3 sB eL ğ?Lqe_gy[}C[t+b!WapW>ƽ>Y_0|K^%\i{*R猹%&!RV\V?cه79|r`x#o?(G7wĿGO|~E{kF"k]ߑc=okPĿ^/ďg ??ࡺ_τaxÚfEƝ6waմJ=rZ#C$x^5qck?kS燼Qvj&cyq*}Q ~?bO~,e xk?'M_$z捩xQu'Qk{ ynx}GK|zyLwI8U'ٴ2mOͳSS<%,= %/_6¿`O>/_6tw^~GwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy;oXH?,n_ۇ@?$hH'hbm_n}6}bNhv>!~I}sŞ,X xC]gV֟Ru;F_=t~.? OOg5~П 5:{hzQյ[Q4 kۈ-m`ycl On |ÏqW N6 _azK6{R^ʅ>gOg /c1O=<Ʀ.\[劽Ē_G#_G#<8ܷG7y}4ƏG G4ƏG GC#g}eb[>_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*?4=l-`O*?<8+?r}_H??8jo?ً-?S?aM_OF.KVm{mGVSҵ;ly-t;i=n(\Cp**=_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZUxy/}wW׶_M|E=?37߰Ū_ ϛK&.ܼz˗r\䕊+Bo9wGL*Bo9wGL*S!A?K?Q-Y:?+E|WG/hQWG/hQd?s8#[uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg+ ǟoZ+ $^MC)ލlclj?= ЊGsZ5LXG~QsYʗ9yjʏ=&.V\P?+~4¨+~4«Lg/?+Q-Y:?+E|WG/hQWG/hQd?s8#[uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;_Txz ~@Y׊m}2>|1jVPGz/Q֙MX]xZMJ2|,F !YḢ\?/C %/C %U+g=QAٗ`Q_Ņ~Ņ~}CÏ*C3z( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=Wÿu?a_Dÿu?a_DP7?;2V +a߂:^a߂:^xqE_fzOCe Ϗ_0lXW/G0lXW/G<8_?3=첏̿Յǯw,+藣w,+藣WYGf_jz}_A?DuZO} ;__}K&zO~H|7.?|=SRֵ?x{Ӵ};GXu ZvpR.. ^?8|7 x  ~W%~%YU _RO.ƯV:8K+4u1QU9! Sr,֜։QVŠw,+藣w,+藯U+g=QAٗ`Q_a/GW4:6kf6:Og~9xX-^}OM?g;8.;?cه79|r`x#o?(G7wĿGO|~E{kF"k]ߑc?EO2f> Y~/5c3\ _/+G(Tejٚkw}Vu+O;vQvÿu?a_DxxpXF|{a+bZ6&IRPT*ѯF'N*Ju!(N1isӜS8O)p_,(8R$Ԣi40lXW/G0lXW/XCÏ*C3zO?;2V +a߂:^a߂:^xqE_fzOCe Ϗ_0lXW/_`Wnտ;x{_e}K^t>9G5>//'byss{>[FϓxW GK֏xW GK־ϯqDYK^ke\/9?ė/ͭ?ė/ͭ}_?w6 ,NO?B%xxOKK?hg}>+W ]C8ާdyiHxW9y8_wW [ xzؼ ̗7Ucغt1tkЧۘ`V*x,~WPBl*ڞ/ G=70T9*(Ԍ?~|_$mh~|_$mk +o!g-xQ@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Z>o!g-Oke\/9ؓo ~ѿ/O< |/i㆛u^hhڎX\js[%7k$=r}Q?d?L_? jٿGS_~ >0f@)ֵ?x{ghv_oi7]!E~ÿHn*q6&>N9\%?[(xel.n a޴k^:i6%>5#7OW˱RZ7N2ˡ({֩&-t~?c 1 ~߇KП 4]:n6mGI4FS/l/m絺)5~+CU9 ?f]t?iQ )C"W+; $_ۮd}'&hӃ]o86[szW~V_G#⯃v?c(~㯆?5oEO asǾ>?oCax[XS_A(o!Up^\~Q_EO,mK#"~(i42͸?,&,GD*T!8*.5TNN/ žG'౵n(agxS̱JqKrӑKhzZTKhzZU^CFς?ߕ>>[szW~V_G#_G#⯰(kG/ ?'G?'G}E^CFς?ߕaOߕ?H??8H??8 (Z6|#}{ B|4ƏG G4ƏG _`QGאѳ/wc_77wo4=l-`O*?4=l-`O*?ּ0?+^П-=+:O?7NI4F>w.Yxտ.׎&ῂ};Mdo%zqÀ0|=Kn|E#f)V3<2>5X2Fk g V; 5l,ᎩVuh̰*eY++/72, \'9㏇1Ğ[szW~V_G#_G#⯰(kG/ ?'G}E93Ըg$a6#+s.OA_Sޯ={lEzU= r?ֱXrY>K˛_? _? (s"}@Ï<>Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aT}?aU@Ͽ?YqЧ݇+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoaBo9wGL*Bo9wGL*pG+??Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? ?¯|=W~:KuطuDŽoQ^ cN|GxzE6jfWyV%*yS~#'mʅ<\*.2]e,0OJ)PEP')a%J.9lӾ? u kL~ P5m?⮛syڽMް|_+qIYlt6O-+~4« +<񧏸AC>y0-^k(?+~4¨+~4« +O/ϻ9q_->Q>_v~ѿHyH<¯/@yKj'k9 F~Z~-~[V+kkQ_? G\ߋy>/xÅBʲ,<_tpyOpK08,9.nT0Xvc%^Xw梫}^ql#ΧX(ap*2 t1xL6`SgOZ= cAߍ0? cAߍ0iO/ϻ>?W>3g~r ƏU~r ƏU}E3V~)aYoaBo9wGL* V$_m쿱gw.VY_cco{6#W#'7/xL%oZ}W/伹m+ ;__}K ;__}K ?cI ?cI_{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQOÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ{{yeQO|?I_'̿4x/\QJ~|Y6zN_X}k?/4>MQӯMZ{߰ _]ums exK|?'3-Oh)o>mͦy%խngO1|>)xOOuڣ!h >鶺垍:Ώs: M{j\~ؓ◄4ѿxP,ɩĺέW>wԿ+¿`O>/_6|gU1RQtԞ"YK'SF4a>IN+Ў"xt֣*O%rҎh>V*1+**nhTRz4W?'G?'GGC#g}_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*?4=l-`O*?<8+?r_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ+'v£ D J4ڧ+B X`H??8__Wڛa?>8| kL3OrnoylTb*e]McrPT[JR袊_G#_G#?<8 +?r(~>4-?x>Oտo6 Էe>a8<5ęc*pXg9'YJ*p#*sB)SO-h2c1QGg*^*׼9MIS׵dO)&Xxa(b8,ҝ>'ϼ/ 1Wp_-< pٌbd%,:x*NV?4ЖWЧsZcqY.? PReG1 saMWR~Q_}?aT}?aU_CG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg( cAߍ0? cAߍ0?Lg/?+Q-Y:?+E|WG/hQWG/hQd?s8#[uV~W_? +rYoq6I^{_l?P\YX8"Ǵֹ}_{ ؊{?/C %/C %U+g=QAٗ`Q_Ņ~Ņ~}CÏ*C3z( X_|zOO(~ `¿oz??c??T|`\nOJ;=Wÿu?a_Dÿu?a_DP7?;2V +%HJv>^'\x~,4_xI/y?Ϸ\}^Guugÿu?a_Dz,Sļ&GW̰.s,XH|140y|X s*XJj`e,Ti?/C %/C %U+ge Ϗ_0lXW/G0lXW/G<8_?3=첏̿Յǯw,+藣w,+藣WYGf_jz}E| ;__}K ;__}K?WL_{,/5a=>?/C %/C %U+g=QAٗ`Q_Ņ~Ņ~}CÏ*C3z( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=+L?K֏a߂:^C<]kfTx'?x^!?nk@YO:j_ΝhssaWWA,{)χKX9p J F_,gV4%J^NZ^XLn,fg8X|D ,ZM{_ sR'`+6e^|?C῁ta/?/ ښ浩dsߴV:ƣjczǙuu<Ņ~>⇉}.arWp\N ļCT0xKTWƅZNu)Pdӝ\:Jxҕ<4Jy^S f."4rB59d֍`Q_Ņ~G;/ h;>\:-& YxSּS}bX-Su[_֯Z}KY*0/BggZSS8o.RgF UxʜJ^&"(?UbIα:Xh6Tط'}qK^f>W~|_$mh~|_$mk +Jq, G_uZ ?cI ?cIQ?XK?_j{\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6_?d?OjٿT?k~  _½s>E^bxI^7(xrnNa_Ɵֱu|pn~!յmQմ NkdSdgOߏxW GK־G<4JŘ|9g,ΗqqTg៱O/|3AaIUX ج,dFO, YN#4SVi,Fqy7,U/EAW.m?~|_$mh~|_$mk +qDYK_' _k<+% kG<+% k_`QG8S`d?,r̿?~~()2~G_uZ ?cI ?cIQ?XK?_j{\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Zأ  1W~Q %|`'!~7o*g#/:}G}|>`rLXg<-Lֲ9}s%o"UpX. ])<&U T1P:_8 QaG*ML=zU,~J5#(_'/_Z?_'/_ZqDYK^/ke\/9?ė/ͭ?ė/ͭ}E_N7Ł?2îxW GK־G gyg/`3o쾯opWZ\җ'6"XIr}V&1T`W~V>>[szW~V_G#_G#⯰+?sB? Ǿ9UQ|;S,Ӽ?TY_xjZ_urE>[7QՒ|?aF/0yaj񟈹l* 3 x>2JkS˨W [(n}<zxl'^aVuqReybkŸ*^t(B:/y%dw M71Z+L-B"ōg]wޝkNB|OdolΠ ?Z?4=l-`O*y80 >c2[\8_2c<?H??8H??8 +?ּ0?+y^П-=+| /`kqQ /`kqWQ?l# G]Xo ][i_ _{hx{Xhf?Ϡ\τZXgM7S^%-h歧5]ңO™J9Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4«)?c7V[;Te&7/?k~^5?cl|68n>uWGž3䙇Q\O#s\;rkձy3MNN]\jJ*iRsjHAajY>OR&oJ3kVӹ!_;G!_;_`Q^_D 8# y~}ُ+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoaBo9wGL*Bo9wGL*pG+??Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4«6iogm}S5~ƿaghWMum^XH>/|e,:IȖ+k?x?c?0Ox?/?Y|}FڟIkqN@[5<'^Җ'|I;ʫ ZLVGNU2T^߾2|_4e¼| 8s'23|BXJ\Н,ԚrXM8~ҧ!_;G!_;_`Q_ǿ3V~)gj[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4« (9 ~{oJUxoye\0?[W_/o_sb1Uq<8hsr__UG[rNnK˖ÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ~W7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~A ;__}K ;__}K ?cI ?cIW7/]Ud~G sK ψ-? KoKV_kRmsλA>Q~ڟt{F?L9^xO෇<| 𶡬\x_ m/SweZ?IӮu;IҬ.59k-3Ov8#~~VYҦydrYgH)d|LYgbrgcqxv1EhڥzΊüG<::g*.nEiԜգJKYa߂:^a߂:^xW GK֏xW GKּ`h>oxƚ77T[VhGX}::N}]?g(y-|`k z77K4[/sVֿh;Xӿt}F:cZygXnۧ#wIcxO7W<= x{Ik!.tmCѴ\:j76famq{{q,q ~?bO~,e xk?'M_$z捩xQu'Qk{ ynx~[!zgָ؟sExa+?TiR>%XkĿ[}[ꑬ>_k |GSa߂:^a߂:^xW GK֏xW GK־ :;oo~_?#?<w,+藯<=xc@5Ϭ\>!]Yi6PXZϮxŚo|KzZΧK<+% k_Tx{: Ş4[> xڝx@֬ԴmsCtt[Gմk3Sy`9"հ?oS?pX~fu糷7cOSS?es?{ܶ.4ƏG G4ƏG X?Ͽ??fxq_ٓo2n3 +i_ _i_ _G,?+0ܷG7y}4ƏG G4ƏG GC#g}eb[>_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*?4=l-`O*?<8+?r𿲱_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ= _™?/"ڟ»^cc;S#TGKO] '|)c ;)^1y#7#O_E?_emσh[Q 56!y]ihڎm6qajw$Zvx?.bW3׼uG;L>.xgMl/ k?tkh6>V 6j ˏ08+f^\7i*8^ GOS Ʀ:YΞ"Zؚu=d'o,Ny\dK/,dpU\hь%4l(4=l-`O*?4=l-`O*!}A3Ï>𿲱_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8 _V#$m쿱{.g>omcaU6# W %?7/L]yoZ/紹o+W~r ƏU~r ƏU{CG3?՟~[uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg+ ǟoZ+ $^MC)ލlclj?= ЊGsZ5LXG~QsYʗ9yjʏ=&.V\P?+~4¨+~4«Lg/?+Q-Y:?+E|WG/hQWG/hQd?s8#[uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf~'qh_qcßg?<}x"{Śwj=[ ]xKn._'Ӵ?Kf:_}WG/hW9lӾ? u kL~ P5m?⮛syڽMް|_+qIYlt6O-\{ 7uEGUЩ w E4̲8L1*gN_^1S/e:XCNM&~Q_}?aT}?aU g 8_e+7Wg( cAߍ0? cAߍ0?Lg/?+Q-Y:?+E|WG/hW9V,Ը$/o6(}O{.O?s}cOS\¯={nlE Ty=3 qqv?ְk>{rK(~ `¿oz?~ `¿oz>|o!=:}QAٗ`Q_Ņ~Ņ~}CÏ*C3z( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=Wÿu?a_Dÿu?a_DP7?;2V +a߂:^a߂:^xqE_fzOCe Ϗ_0lXW/G0lXW/G<8_?3=첏̿Յǯw,+藣w,+藣WYGf_jz}E| ;__}K ;__}K?WL_{,/5a=>?/C %/C %U      !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~+g=QAٗ`Q_Ņ~Ņ~}CÏ*C3z( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=Wÿu?a_Dÿu?a_DP7?;2V#f L~_}k_F JgE/w,+藯޼xCo gf~"d < xjf\?~!G!X/ ?~PoOIğ5'|a]XaxKL}O'X1?/C % ? y72/a쾯oq7}k޿SΗ'=6"8H}V&0ܶx_=.nogh۟| ?cI ?cIW?XK?_kr̿?~~()2~G_uZ ?cI ?cIgX? _!:q O,/_ uO,9'oG&?MO+ x[3|;pС#^&x1"x{;3ΤqX?}SC RQ`Ž+-̩TS0P*^S8mѫڝ?i!8/_'/_Z?_'/_Z>o!g-yQ@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Z>o!g-Oke\/9?ė/ͭ?ė/ͭ}E_N7Ł?2îxW GK֏xW GK־qDYKS _k<+% kG<+% k_`QG8S`d?,r̿?~~()2~G_uZ ?cI ?cIQ?XK?_j{\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_ZlßSo+oCT~$»᎗??xEw!~#D?'I&4VnH!E} KKC8K.p~6_2XT˰.>n>3 xgVN{JyWx5STl:tO4sER dru2RjZ(U<+% kG<+% k_`Q_!?XK?_kr̿?~~()2~G_uZ ?cICg>x^%eh!5(5-\6{;Vm:L.n, X%Fآ|QYO啣9+2ԧ`<+e6]M,Y,6?'G?'G}E|אѳ/wn_aOߕ?H??8H??8 (Z6|#}{ B|4ƏG G4ƏG _`QGאѳ/wc_77wo4=l-`O*?4=l-`O*?ּ0?+^П-=+| /`kqQ /`kqWQ?l# G]Xo ][i_ _i_ _!g_?Lװ'no_KhzZTKhzZUy>`W~V>>[szW~V_G#_G#⯰(kG/ ?'G?'G}E^CFς?ߕaOߕ?H??8H??8 (Z6|#}{ B|4ƏG G4ƏG ]|*jտ|uoauOox?Ꮚëimߓ{;Y%_~+c ~/O]?pφ*cğ x]Qv7:jc12E 8 `W~V>>[szW~V_G#⯪<=Z^<#>O3:/o젺s=s4YM׉|CK{m<6imqExqftpAҥ9Nu|OWYgIQ"=*R(Z+Z1T8\#m?+~4¨+~4« +O/ϻ:?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aT}?aU@Ͽ?YqЧ݇+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoaBo9wGL*Bo9wGL*pG+??Ϭ G0~}!_;G!_;_`QGD 8# y~}j[||>_? _? ("}@Ï<>?q_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aT}?aU@Ͽ?YqЧ݇+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3gOo~o sķ~-k:1xOY/Vӭm;VLҵ;(oR .Ki>'}">>7?n7 _ a,5ɾÌ?ֿ_Y_{a}=K9cqXL^+ ˖&b5eOr敮3տ cAߍ0? cAߍ0? g8S\Wϔݟ}?aUG ŚxG .ezΧkRhi/_6¿`O>/_6wtw^~GwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/G0lXW/G<+% kG<+% kGtw^~AwTy0lXW/_7k%:Ol 2&,ZI-oG5N-44k}^[J{??_'/_Z~Ŀoχ?o[oQw%O*>h oWԗ\޳xNwAs-Xe~g'Y_ qmGs,FeV[JfLv O+ҞUqT150J1u^ eCg09~&a*as:ӭN:S1hԦLN)')njJ0lXW/G0lXW/G<+% kG<+% k_Gx?G?/Ņ~Ņ~¿`O>/_6¿`O>/_6GG?/Ņ~Ņ~¿`O>/_6¿`O>/_6GG?/Ņ~[?<'#Iw{?ǣxK+ZsŒG?ė/ͭ~W_G?)Kf{ ?bxET🀿09GO}OsroR[ 3WQCO rOs*8e\e[LK8..^GYSd6<j5s5#2lvcjN2pԚUgQ:8x{ z ETÿu?a_Dÿu?a_D?ė/ͭ?ė/ͭ~W7/G?/Ņ~G;/ h;>\:-& YxSּS}bX-Su[_֯Z}KY~W~|_$mk 0b8Q_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*?4=l-`O*?<8+?r_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>أ  1W~Q %|`'!~7o*g#/:KhzZU/Kc~OocƵoſV ZENjve;LC@m?@Aoes~#oq\Wx}7Sk؉@pPxL'3TZkCG ATaaKJh{nOQsVʖeO [uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg( cAߍ0? cAߍ0?Lg/?+Q-Y:?+E|WG/hQWG/hQd?s8##-[ xFBkZ x?wVvw^Gǧx'Jm*/n5 $%[kkOHgן h_w]7x- Iֿb߉ѿEx">.ӵ;GGg?IgEL?^ }%sn L^9piOğ E|-(r ڼ*}qSWcrX, NANfeB8Z7q*1pM0ٍ.zJ-¬?vT( cAߍ0? cAߍ0fU29#Q-Y:?+E|WG/hW9V,Ը$/o6(}O{.O?s}cOS\¯={nlE Ty=3 qqv?ְk>{rK(~ `¿oz?~ `¿oz>|o!=:}QAٗ`W_`Ņ~öeOk-/C^?kOA1H/M>_s=\CpC긜,eoi_Be)%^b\>+4ܯ.Y^xIƤk;f}E| ;__}K ;__}K}CÏ*C3zy( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=Wÿu?a_DxoU0~_>wH5I>,D;ŸM~??~Mf΃xwm(DsO-)ckSWp$UWPVNJrNu%hFN:Qe؊CW;RЫR\r,!K*RvNыn ?/C %/C %W?eve/>=Wÿu?a_Dÿu?a_DP7?;2V +a߂:^a߂:^xqE_fzOCe Ϗ_0lXW/G0lXW/G<8_?3=첏̿Յǯw,+藣w,+藣WYGf_jz}E| ;__}K ;__}K?WL_{,/5a=>?/C %/C %U+g=QAٗ`Wɂ|^`?~ `¿ozK~y?چq |/mOhݖk7h='N.t'J{٬>I +hs®{ſ +g> 1#g,Ηppm.qTg_S0\MB8iRj4 20{ήokӭюW,|Fqy4_ECrKt~Wɂ|^`?~ `¿ozK~y?چq |/mOhݖk7h='N.t'J{٬>I +h8[|*[Ҷs#>vqp'G a[GF~%j3#&Mj,`, g<:0rʤgsIT9l$GE0lXW/G0lXW/_CÏ*C3zx^( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=Wÿu?a_D}^sVW\3[E9}.&/{[~ǶG Oֿ7ܼms>O_'/_Z?_'/_Z>o!g-z}Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Z>o!g-Oke\/9?ė/ͭ?ė/ͭ}E_N7Ł?2îxW GKֿ+_GS7*Ɵ|qc_D<X_ؾ(~?jdt}>-Ѕ\Yf80e?^xLO-*52ΗnqpNyw#g~Wey^::[:a{J3YTrV_'/_Z?_'/_ZqDYK^ke\/9?ė/ͭ?ė/ͭ}E_N7Ł?2îxW GK֏xW GK־qDYKS _k<+% kG<+% k_`QG8S`d?,r̿?~~()2~G_uZ ?cI ?cIQ?XK?_j{\s/:-~?~|_$mh~|_$mk (Jq, =Q@9p¿`O>/_6¿`O>/_6}Ï%8CZ(_sK__'/_Z?_'/_Z?ooڻNP ; CS_&FoGZm9c TRt?ė/ͭ?ė/ͭx _sU@Q'࿈//_j/ aٯ?H+.ܣ8_|? ;2&p_,o)4~C깆>yV? 51*%⭃P*^e aWG[g/mSgUi'Zp'o_'/_Z?_'/_ZqDYK^/ke\/9?ė/ͭ}Q.4?xO\Oog|5_jvZցZRѵYgӵmVӮmN YXm+1=Y _™~>ċZ# w?ѴG'uY`)8-7^/J5O㍯p_POЫҔ_Xay)5*>]`W~Vo ][i_ _i_ _!g_?Lװ'no_KhzZTKhzZUy>`W~V>>[szW~V_G#_G#>~O>:o7qϰ麧7<!Y:>iwaմ6=լo|Ueo>տu#okatxᏅC=[3EӴ};GXo/>ä:m{;[X>;ZjxcW?UߴNS~ߨr{l{eAb9=&ͮKZG /`kqQ /`kqWWy>`W~Vo ][i_ _i_ _!g_?Lװ'no_KhzZTKhzZUy>`W~V>>[szW~V_G#_G#⯰(kG/ ?'G?'G}E^CFς?ߕaOߕ?H??8H??8 (Z6|#}{ B|4ƏG G4ƏG _`QGאѳ/wc_77wo)Og~??fg!G+=[a/v\?k~^)  j?coJk8n>k$f?n_O؏;sG//O 쟵?L;A|iڵ쿼?_ ~(~_[^Ϭ G0~}!_;_7_Oy0hoCCOKb߉ٞ? _۫@쿰,4[oZn~ K|^Oa<[<Yd5|= *9^"X 𓔾Rm6ܯ<0F#G콽5}sOZ﫹!_;G!_;_`Q^_D 8# y~}ُ+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoa'n|pCW෋?j?_O9_[~Ŀ5<'hwZiŶ\ͦ\_Z7Z} %Wo o W!~-<1OF.IӮu;ISҴ)^y-t(;hB(S"b?_}[[_KM}]nWOGm}[VY?G'jo#wn cAߍ0? cAߍ0 g8Sq_->Q>_v|WG/hQWG/hWQ>gB_vڸ(/ϻ>?+~4¨+~4« (O/ϻ\Wϔݟ}?aT}?aU@Ͽ?YqЧ݇+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU~r ƏU}E3V~)aYoaBo9wGL*Bo9wGL* ]')^ s|A˸|'g?ڿ8ͽGV[?m}So^k\= V}=[lrn/0_VmOc,\%Gࡿ|9[Ouč#ⅅͯl.YmxNGN5ż:UGEW6l}?aUx82qոOü/?Wʱ|G,y|,W )Fg,.%sRxJ\67SsJ\.3`,'t*b/z΅{g~r ƏU~r ƏU}Ex?3V~)g7+}eg?Ϗ cAߍ0? cAߍ0? g8SW>3g~r ƏU}EICcp 7\YW뜾~eNlF*'G Nn_Krߟ(Kr_iyr۞Ww,+藣w,+藣~~Կ㣿=˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿oz?~ `¿oz?_'/_Z?_'/_Z?㣿˿̟?~ `¿ozֿk_GƟxwk&u/-tyKc~8Kӣ~ѿo]|Y>/|>g~?5Z_ h'0im{,!}Zn?gKt|e jpσ)E~0ɱX$16KS%XpWX?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*?4=l-`O*?<8+?r_G#_G#!}A3Ï>?_-Qf}E| /`kqQ /`kqQ>řE~fX(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?w/?|+?_}'㎩ ϴ™??7I<S􂿝 lo^eF><[|? YOgWC_մO7MkY^ZGI/iԼeެV:G?'G~⧆|-˼!<#q#7\řE~fx_X(?ϳ>?H??8H??8?ϳWwٟ`Q_KhzZTKhzZT?Ͽ??fxq_هV+~x?ϰ(4=l-`O*<վ+k{/n&"˟?kOCo}b~}g͈r{Ia|fn^[Vog~e9y.[J!_;G!_;^ g~q_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg( cAߍ0? cAߍ0?Lg/?+Q-Y:?+E|WG/hQWG/hQd?s8#[uV~W_? _? TpGx/2W~r ƏU~r ƏUCG3?՟Ϩq_՟?+~4¨+~4¨U29#}G Cf!_;G!_;G gs8_e+7Wg+? \пCյE<OTc7Og5?Xym>J/n _? o&; Cςk>$i,/ƿt]~mEnj<'kgyukt(UEIU~VzIS-'ψңx.-ɴ㇆62-7䔥}ZWÿu?a_Dÿu?a_D{P7( X_|zOO(~ `¿oz?~ `¿oz>|o!=eve/>=Wÿu?a_Dÿu?a_DP7?;2V +a߂:^a߂:^xqE_fzOCe Ϗ_0lXW/G0lXW/G<8_?3=첏̿Յǯw,+藣w,+藣WYGf_jz}E| ;__}K ;__}K?WL_{,/5a=?0Ox?/?_ ?? b7_i~ڞ/-?M/4o zNs\NaqlYi}Vÿu?a_D~U> x> 1l9_R^)9S\iwIqGfWfu)唣r|?/C %/C %?xqE_fzOO e Ϗ_0lXW/G0lXW/G<8_?3=첏̿Յǯw,+藣w,+藣WYGf_jz~?`<_%g tf{Ϗ S'X~8|2_Z? 4k<r~gu3ÖfS{aeiV>=Q ;__}K?H&ď8|NJ\oxdt,>SdfgbF5q8<-QcvW VEŘ̫7,5sp+2KK pѭ =yRz^HJjS(N2`Q_Ņ~Ņ~<8_?3=,/5a=>?/C %/C %U+g=QAٗ`Q_Ņ~|- xs큨џ e|;Z`OQ= u+_uďlM;VKS,NΩr|ļږE3gf>Ma8L#8gr3V1n':ѫ mG*+ BXKѪhΝ9+fTFZtV-5:8Bw,+藣w,+藯/Weve/>=Wÿu?a_D}^sVW\3[E9}.&/{[~ǶG Oֿ7ܼms>O_'/_Z?_'/_Z|6C u}>С?:>?8Kad?,ZQef^'?G_'/_Z?_'/_Z|6C u}>С?:>?8Kad?,iřt/IxW GK֏xW GKֿ8 P}(|OϾo?XYK/_j)f]?iR3w~~/{o>'_G= c[Ï$CZyFYOazԟ~|_$mh~|_$mk1`mB.7ŅQef^'?G_'/_Z?_'/_Z|6C u}>С?:>?8Kad?,iřt/IxW GK֏xW GKֿ8 P}(|OϾo?XYK/_j)f]?iR3w~~/{o>'_G= c[Ï$CZyFYOazԟ~|_$mh~|_$mk1`mB.7ŅQef^'?G_'/_Z?_'/_Z|6C u}>С?:>?8Kad?,iřt/IxW GK֏xW GKֿ8 P}(|OϾo?XYK/_j)f]?iR3lßSo+oCT~$»᎗??xEw!~#D?'I&4VnH<+% k__(|OϾ{o>'___#pgX,ax>40") O |43 M5XUZTJ~eey""]*x ӆUruO~j5g6~¿`O>/_6¿`O>/_6`mB|6C u}%^ׁO(23L/^_y?ė/ͭ?ė/ͭ~q>С?:>? P}%^S4b̺ חg<+% k_O1hpY~?<]+G^}ac{< ^ֵy1Xg4V)|=G$ M`mB|6C u}?.//pX>$xqxq'|iS2*^WJ •oʖ* VuetztuUey.:)֧˓ӌH~|_$mh~|_$mk1`mBo?XYK/_kf]?iR3w~<= ?-}LKNZ R:؈6=wcZ2X(ƞ ӕrkNT?ٍ$Dd  c ^A:..\..\..\thesis\ccgcacrc.jpgR#O%& "[ty#BF#O%& "[tyJFIFCC<" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(Cr_-'=ׅN k>!-c_մgF ikr]jz_?_?!}A3Ï>?_-Qf}E| Fq|hz Fq|hz>řE~fX(?ϳ>?h84hh84h?ϳWwٟ`Q_k}Ѵ~_?^k}Ѵ~_?^?Ͽ??fxq_هV+~x?ϰ(5?cN//Z?5?cN//Z?<8+?r?<C~OKj3/W/4xPտ[o6Էm'Ə|^|je᛿lwƏg {o;$_쏱ȹ{^97”eO\ |0o>(xgo|s|HWi>4υZƳ4xAԮ4K[5G_201<;ZJGbUIөUJx<;̱(Ғ&aQӥ:Z'|l4O ((%CN9]kTl('h)J)QE|W!-Z鿷OQ;V5=N~Gsxb{_hw>,|O⛍EX2:VI뚶7?!__'@}.SR~#e NQTtx:mMҫV[Rq唽&|-eK6[J咍e%tڳ`Q_4|h~E~4|h~E~ gw/2W?!__'@?!__'@CG3?՟Ϩq_՟?hI ??hhI ??hU29#}G Cf3GƏHWW ;G3GƏHWW ;G gs8_e+7Wg(>4Bl"`O?>4Bl"`O?Lg/?+Q-Y:?+E| ` `d?s8#[uV~W? Sz(Pi~OX:=SRto*Ӵ};GXt&헐R.fvPQN_U\pձ8JxZ=*eR;SJJ4xiԌcO.6*sp)TRW+#VSn*pm%8 +fvfvU29#?Q-Y:?+E| ` `d?s8#'_a%?/7b/kbΓkU%l%{v W7`xo(?SOFKD߄?cmV_bj?.>O]3M'pG^q f){|I`> bd9ęna`0|ǁ0nc^ _ \N.jB5dnqXW08fl&2\M*QSZR SHr|SAE| ` `CG3?՟q_՟?hI ??hhI ??hU29#}G Cf3GƏHWW ;G3GƏHWW ;G gs8_e+7Wg(>4Bl"`O?4 ş>$|pnuN|P:e5k |*Ag'ԭ׺ֹsGXiniey~piYe8A`2/3~U<|%=楍FNƶ*|&WKQa==+.dH+0W-_|o!=?;2V +w F;4|*w F;4|*xqE_fzOCe Ϗ_;> G;> G<8_?3=첏̿ՅǯююWYGf_jz}E|?cFQ?cFQ?WL_{,/5a=>?zc#Gbzc#GbU+g=QAٗ`Q_ý`O11Tý`O11T}CÏ*C3z( X_|zOO(޿'_?޿'_>|o!=eve/>=^D[t/ZO~W_w?h/U_w?h/U}?8xqžmq/c@+!׿׬<;ooϮ>~F/(`rfQe; &{e=Kߗ;> G;> _?WL_{,/5a=>?zc#Gbzc#GbU+g=QAٗ^ثz]~W?L_/;5x{u(–k_o=g/}BtGX}:{onh>&Ckڳ'_w?h/U~Ƶ6 x}y/r\gx#9ZSUtp BGe+xTXlmҎ\W/ *3L=LYvN 8| QSYq* Pwюю>|o!=<eve/>=W_w?h/U_w?h/UP7?;2V +w F;4|*w F;4|*xqE_fzOCe Ϗ_;> _Tx{t ~ x[> xkex{@ltmCѴ-'Gtkk 3L80/BggZSS8o.RgF UxʜJ\`W&:`aGSbܝi -yآ+9OCc|$ƿxkRQs{X;~߶狴 &{ ?xO{ּ-}YL[@֬ KFkqḾ Е`oD?am4k|06 YJ5[֥e*)qEF(RtOÚ KœV"eV(*yY3Y)FEqMZ] _+h _+hO{cφFAG=#o??5O??ZKWϔcfn&7lWG7lW_ ?悏{cφFAGI'K__js?/Ikw _}4Q _}4W'=#o?XsQ|sAZO=?kRo?q|+z q|+z oh(?am4kxkD>S@9Oԛ_J?^CE_J?^CE~"k|06 ?>y'?-}ϔcfn&7lWG7lW_ ?悏{cφFAGI'K__js?/Ikw _}4Q _}4W'=#o?XsQ|sAZO=?kRo?q|+z q|+z oh(?am4kxkD>S@9Oԛ_J?^CE_J?^CE~"k|06 ?>y'?-}ϔcfn&7lWG7lW_ ?悏{cφFAGI'K__js?/Ikw _}4Q _}4W'=#o?XsQ|sAZO=?kRo?73|g} rH[CŸG0 *o:> ēK{-WwUFDұI.S _+hO{cφFAG=#o?l&soX.nO/㼢 e\=y5z}؜XΤjƅlʶ* Ύn?2˳*l'O`"ft#G+˰yfMO)ZSԔeZU%S5w _}4Q _}4W'=#o?XsWkxkD\O=?kRo?q|+z q|+z oh(?am4kxkD>S@9Oԛ_J?^CE_J?^CE~"k|06 ?>y'?-}ϔcfn&7lW_Hx:/ď >44Y} Yvykx⇆|̺[iښkZg}GOm?>y ?悼0 hC!-*ZyxeN(a0|#iוWFqKV)¥'ƭ+ S7*88[XSad(7RI%(6ԗE0 ?悊o˧oI~'1TableITSummaryInformation(DocumentSummaryInformation8,CompObjj i0@0 Normal_HmH sH tH H@H Heading 1$<@&5CJKHOJQJF@F Heading 2$<@&56CJOJQJ@@@ Heading 3$<@& CJOJQJ<A@< Default Paragraph Font0Z@0 Plain TextOJQJ.. Footnote Text8&@8 Footnote ReferenceH*(U@!( Hyperlink>*B*>V@1> FollowedHyperlink >*B* phJT@BJ Block Text07$8$H$]^0CJaJ, @R, Footer  !&)@a& Page Number2B@r2 Body Text ]CJ:'@: Comment ReferenceCJaJ,, Comment Text.P@. Body Text 2CJ`$%}~3@Rjkabop6 I J k l ;<  IJz p!q!$$:$;$))**[-\-0000X1Y1x112225577G8H8]8^8~:: > >DDII2IOIPI-N.NPPWWYY%\&\cccllosz?L]^KLҘӘޘvwZ[ÛěST*+lm\]-.XZ*+opnoƩǩUV:;UVJK߯opSTIJ·÷z{ }~IJWXQRSTV[`jpsuz½ǽϽӽؽݽ&*/4=?EJKPRZachmuw|ľ̾ξԾپ%'-2;=CHIMPW^agltw}ȿ˿пտ޿ !&+46<ABFHQ[^chpsx} !*,278=@KVZ`empuz "'039>?DFMTW]bjmsx "+-389>@KTW]bjmsx "$*/068?JMRW_afktv| %*+,  9:?GIOT PQVbekp"#(25:?xyz 34;CFKP:BEJO.69>CRSv}#$=FHNS OPovy./RY\bg%.17<tu ()=DGLQ`aGHfnqv{ ?GJOTcd #$19<AFUVx"#;BEJO )*R]`ej@Adloty *149>+47<AXYKSV\a%*;<GORW\(*/4:=?DEZ]fiouvwx36BEJPQru~"(./CFQTY_`.19<AGHIJSV\bcdempu{| CFOQW]^~ DGORX^_wz;>ILQWXcfqty  +.79?EFhksuz 47@CIOPhktv| [\^cilns|} -58=BQRgorw|'.17<lm$%9ACHMjk )+16pqAILQVdefijlqv| "-05;<=>GIOUVWXachno !"-05;<]`ikqwxyz$&,2345=@EKLMNUX]cd  &'47BEJPQRS^aflm #(./RU^aflmnoxz %(-34CENPV\]^_jmrxy  ),178ehsv{!$)/0ILTW\bcux  &'ACNPU[\qtefghijklmopYZ\]0000%0%0%0%0%0%0%0%0%0%0%0%0%0%0%0%0%0b0b0b0b0b% 0b% 0b% 0b0b0b0b0b0b0b0b0b0b0b0b00 0 0 0 0 0 0 0 0 0 0 0 0 0 (0 0$0$0$0$0$0$0$0$0$(0 0000000000000000000000000000(0 0H80H80H80H80H80H80H80H800(0I02I02I02I02I02I02I02I02I02I02I02I02I(0I0c0c(0I(0I(0I(0I(0I(0I(0I(0I(0I(0I(0I(0I0(0I0L0L0L0L0L0L0L00000& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0 Ә0Ә& 0 Ә0Ә& 0 Ә0Ә& 0 Ә0Ә& 0 Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0Ә0Ә& 0 Ә0Ә& 0!Ә0Ә& 0"Ә0Ә& 0#Ә0Ә& 0$Ә0Ә& 0%Ә0Ә& 0&Ә0Ә& 0'Ә0Ә& 0(Ә0Ә& 0)Ә0Ә& 0*Ә0Ә& 0+Ә0Ә& 0,Ә0Ә& 0-Ә0Ә& 0.Ә00@00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0000000000000000000000000000000000000000000@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@000000000000000000000000000000000000@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@0@000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000@0@0@0@0@0@0@0@0@0@0@0 @00@0@0@0 0 &I2<hIL[rL1BcK*{  AUh6 *(y?kf˵$Xeqy G]1D!4 DW-7n"bQyFc/)iQ!_|.TD~TI#a# !9p}@ZGQh,Or "e'5Mr*@pFh (WtTiExU/aw%3Idr $R_5Bl0Xw1Uz )Oi[l":kyr\ {      !"#$%&'()*+,-./0123456789:;<=>?@BCDEFGHIJKLMNOPQRSTVWXYZ[\]^_`abcdefgijklmnopqrstuvwxyz{|}~z  :: !!l,b$ ?D@0(    B S  ? _1088858222 _1088857645 _1088857797 _1088857823 _1088857926 _1095711105 @@@@@@ %itfst~5?@ G / : %*8=bgdjnw="C"I"S".#6#k#s#Y$d$i$s$'' (*(G.K.//9/:/>/0011v5{555::K=V=>>AACCC CEEFFFFGGGGHH&O*O5O9OSQWQcRgR SSTT8\<\\\]]0^4^'a3abbkkn nnnttuuvvrx{x-y4yzz}}}}}}~im7;xՎَ9=[_w!io/5՛ݛ TYbg+1Ÿȟ͟ӟݟ 7BҠՠ"/0:Ρס .6[_ty "Zb %.5/5IPĥӥ (æɦܦpuou{Ш֨ ǩͩөة:CV[di;@HQW^difsʬЬ٬V^yKR^f(6CDNpvðɰTZcktzɲϲ `f $'L\t۵)ֶ߶kw÷ҷ8C{ϸ۸SYhqйٹ@M~JNclrv|cntzuy~U\ #IPhj$$Y_Pcmy<MOW%)/W^Zar!$0LS U[CPANHN  LT@Igl09<Fbht?C&QWXf-| +_l]gnr||HOR^ BH"%-`h <CT^_h(/\beeoyzmv5<=IAH'4%$$<MZa!LSLT||HOBH`heeMMdd''QQRRmm//mmnn44]]^^yycc''euwIC:\Documents and Settings\Administrator\My Documents\biology\nar2S446.docuwIC:\Documents and Settings\Administrator\My Documents\biology\nar2S446.docuwIC:\Documents and Settings\Administrator\My Documents\biology\nar2S446.docuwIC:\Documents and Settings\Administrator\My Documents\biology\nar2S446.docuwIC:\Documents and Settings\Administrator\My Documents\biology\nar2S446.docuwIC:\Documents and Settings\Administrator\My Documents\biology\nar2S446.docuwIC:\Documents and Settings\Administrator\My Documents\biology\nar2S446.docuwiC:\Documents and Settings\Administrator\Application Data\Microsoft\Word\AutoRecovery save of nar2S446.asdtompaZ:\tompa\tfbs\nar2S446.doctompaI:\www\papers\tfbs.doc& &, M  ;q n[HCE  28vh9.xBmr2! -  `-  ZOq."B"xJ"! 41'R(Bk `-uqZ.%i/ %N:efC:DCU(CtEGbE6xN,H0YI2p'SxrV<>n_Z:ic` a ev'(mYh@{lH_p `Mu 3(}G^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`.^`.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.hh^h`o(.88^8`.L^`L.  ^ `.  ^ `.xLx^x`L.HH^H`.^`.L^`L.hh^h`.hh^h`o(.88^8`.L^`L.  ^ `.  ^ `.xLx^x`L.HH^H`.^`.L^`L.hh^h`.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.h ^`OJQJo(^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.hh^h`.h^`.h^`.hpLp^p`L.h@ @ ^@ `.h^`.hL^`L.h^`.h^`.hPLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.h    SA Statistical Method for the Discovery of Novel Transcription Factor Binding Sites St Martin Tompa Meartart Normal.dotatompa.d33pMicrosoft Word 9.0d@,H@RP#z@71p@oy|$F՜.+,D՜.+,L hp  +Donated by Intelik SA Statistical Method for the Discovery of Novel Transcription Factor Binding Sites Title 8@ _PID_HLINKSAT K..\..\..\thesis\cggagwwa.jpgC..\..\..\thesis\aawtttty.jpg[..\..\..\thesis\ccgcacrc.jpg  FMicrosoft Word Document MSWordDocWord.Document.89q^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.h ^`OJQJo(^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.hh^h`o(.hh^h`o(.88^8`.L^`L.  ^ `.  ^ `.xLx^x`L.HH^H`.^`.L^`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.hhh^h`.h88^8`.hL^`L.h  ^ `.h  ^ `.hxLx^x`L.hHH^H`.h^`.hL^`L.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.hh^h`.hh^h`.^`o(.^`.pLp^p`L.@ @ ^@ `.^`.L^`L.^`.^`.PLP^P`L.&i/`Mu- M - _p(mYhR(eh9.2%N:BmrbEC_Z{l,HCE auqZ.J"fC'Sq."0YIrV3(}CtE N,H41'`k `-ic`;q &&         TV[`jpsuz½ǽϽӽؽݽ&*/4=?EJKPRZachmuw|ľ̾ξԾپ%'-2;=CHIMPW^agltw}ȿ˿пտ޿ !&+46<ABFHQ[^chpsx} !*,278=@KVZ`empuz "'039>?DFMTW]bjmsx "+-389>@KTW]bjmsx "$*/068?JMRW_afktv| %*+  9:?GIOT PQVbekp"#(25:?xyz 34;CFKP:BEJO.69>CRSv}#$=FHNS OPovy./RY\bg%.17<tu ()=DGLQ`aGHfnqv{ ?GJOTcd #$19<AFUVx"#;BEJO )*R]`ej@Adloty *149>+47<AXYKSV\a%*;<GORW\*/4:=?DEZ]fiouvwx36BEJPQru~"(./CFQTY_`.19<AGHIJSV\bcdempu{| CFOQW]^~ DGORX^_wz;>ILQWXcfqty  +.79?EFhksuz 47@CIOPhktv|^cilns|} -58=BQRgorw|'.17<lm$%9ACHMjk )+16pqAILQVdelqv| "-05;<=>GIOUVWXachno !"-05;<]`ikqwxyz$&,2345=@EKLMNUX]cd  &'47BEJPQRS^aflm #(./RU^aflmnoxz %(-34CENPV\]^_jmrxy  ),178ehsv{!$)/0ILTW\bcux  &'ACNPU[\qte@t$&W)W*wxoooo`@`(`X@`0`d@``@``h@``@UnknownGz Times New Roman5Symbol3& z Arial?5 z Courier NewG MS Mincho-3 fg"1h/Pjj۳jF! $Fkm& p!0dv1-Q 2QRA Statistical Method for the Discovery of Novel Transcription Factor Binding Sites Martin Tompatompa